ID: 1107857946

View in Genome Browser
Species Human (GRCh38)
Location 13:44633951-44633973
Sequence GCTTGTAATCCCAGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 837595
Summary {0: 8256, 1: 229629, 2: 273895, 3: 182802, 4: 143013}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107857940_1107857946 8 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857946 13:44633951-44633973 GCTTGTAATCCCAGCACTTTGGG 0: 8256
1: 229629
2: 273895
3: 182802
4: 143013
1107857935_1107857946 23 Left 1107857935 13:44633905-44633927 CCATCTCAAAAGAAACCAAAAAA No data
Right 1107857946 13:44633951-44633973 GCTTGTAATCCCAGCACTTTGGG 0: 8256
1: 229629
2: 273895
3: 182802
4: 143013
1107857944_1107857946 -5 Left 1107857944 13:44633933-44633955 CCGGGCGCGGTGGCTCAGGCTTG 0: 10
1: 1577
2: 37442
3: 95224
4: 158880
Right 1107857946 13:44633951-44633973 GCTTGTAATCCCAGCACTTTGGG 0: 8256
1: 229629
2: 273895
3: 182802
4: 143013

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107857946 Original CRISPR GCTTGTAATCCCAGCACTTT GGG Intergenic
Too many off-targets to display for this crispr