ID: 1107857947

View in Genome Browser
Species Human (GRCh38)
Location 13:44633954-44633976
Sequence TGTAATCCCAGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1035426
Summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107857944_1107857947 -2 Left 1107857944 13:44633933-44633955 CCGGGCGCGGTGGCTCAGGCTTG 0: 10
1: 1577
2: 37442
3: 95224
4: 158880
Right 1107857947 13:44633954-44633976 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1107857935_1107857947 26 Left 1107857935 13:44633905-44633927 CCATCTCAAAAGAAACCAAAAAA No data
Right 1107857947 13:44633954-44633976 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1107857940_1107857947 11 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857947 13:44633954-44633976 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107857947 Original CRISPR TGTAATCCCAGCACTTTGGG AGG Intergenic
Too many off-targets to display for this crispr