ID: 1107857949

View in Genome Browser
Species Human (GRCh38)
Location 13:44633960-44633982
Sequence CCCAGCACTTTGGGAGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 888921
Summary {0: 114360, 1: 259489, 2: 214307, 3: 130302, 4: 170463}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107857944_1107857949 4 Left 1107857944 13:44633933-44633955 CCGGGCGCGGTGGCTCAGGCTTG 0: 10
1: 1577
2: 37442
3: 95224
4: 158880
Right 1107857949 13:44633960-44633982 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
1107857940_1107857949 17 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857949 13:44633960-44633982 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107857949 Original CRISPR CCCAGCACTTTGGGAGGCCG AGG Intergenic
Too many off-targets to display for this crispr