ID: 1107857951

View in Genome Browser
Species Human (GRCh38)
Location 13:44633963-44633985
Sequence AGCACTTTGGGAGGCCGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 536358
Summary {0: 87986, 1: 182858, 2: 138884, 3: 74939, 4: 51691}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107857944_1107857951 7 Left 1107857944 13:44633933-44633955 CCGGGCGCGGTGGCTCAGGCTTG 0: 10
1: 1577
2: 37442
3: 95224
4: 158880
Right 1107857951 13:44633963-44633985 AGCACTTTGGGAGGCCGAGGCGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
1107857940_1107857951 20 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857951 13:44633963-44633985 AGCACTTTGGGAGGCCGAGGCGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107857951 Original CRISPR AGCACTTTGGGAGGCCGAGG CGG Intergenic
Too many off-targets to display for this crispr