ID: 1107857952

View in Genome Browser
Species Human (GRCh38)
Location 13:44633964-44633986
Sequence GCACTTTGGGAGGCCGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 867824
Summary {0: 84291, 1: 218536, 2: 234154, 3: 158283, 4: 172560}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107857944_1107857952 8 Left 1107857944 13:44633933-44633955 CCGGGCGCGGTGGCTCAGGCTTG 0: 10
1: 1577
2: 37442
3: 95224
4: 158880
Right 1107857952 13:44633964-44633986 GCACTTTGGGAGGCCGAGGCGGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
1107857940_1107857952 21 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857952 13:44633964-44633986 GCACTTTGGGAGGCCGAGGCGGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107857952 Original CRISPR GCACTTTGGGAGGCCGAGGC GGG Intergenic
Too many off-targets to display for this crispr