ID: 1107857953

View in Genome Browser
Species Human (GRCh38)
Location 13:44633967-44633989
Sequence CTTTGGGAGGCCGAGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596589
Summary {0: 39056, 1: 119917, 2: 190535, 3: 147315, 4: 99766}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107857944_1107857953 11 Left 1107857944 13:44633933-44633955 CCGGGCGCGGTGGCTCAGGCTTG 0: 10
1: 1577
2: 37442
3: 95224
4: 158880
Right 1107857953 13:44633967-44633989 CTTTGGGAGGCCGAGGCGGGTGG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
1107857940_1107857953 24 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857953 13:44633967-44633989 CTTTGGGAGGCCGAGGCGGGTGG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107857953 Original CRISPR CTTTGGGAGGCCGAGGCGGG TGG Intergenic
Too many off-targets to display for this crispr