ID: 1107873565

View in Genome Browser
Species Human (GRCh38)
Location 13:44769050-44769072
Sequence TCACTTCCAAACGACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107873563_1107873565 -1 Left 1107873563 13:44769028-44769050 CCTGAGATATGGTTTACTTCCTT No data
Right 1107873565 13:44769050-44769072 TCACTTCCAAACGACCAGCCTGG No data
1107873562_1107873565 0 Left 1107873562 13:44769027-44769049 CCCTGAGATATGGTTTACTTCCT No data
Right 1107873565 13:44769050-44769072 TCACTTCCAAACGACCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107873565 Original CRISPR TCACTTCCAAACGACCAGCC TGG Intergenic
No off target data available for this crispr