ID: 1107873698

View in Genome Browser
Species Human (GRCh38)
Location 13:44770336-44770358
Sequence CTGAGCTAAGCCAAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107873692_1107873698 27 Left 1107873692 13:44770286-44770308 CCTCTGTTGGGACAGTTGTCATG No data
Right 1107873698 13:44770336-44770358 CTGAGCTAAGCCAAGTTGGATGG No data
1107873696_1107873698 -9 Left 1107873696 13:44770322-44770344 CCAGATGGTCTCTTCTGAGCTAA No data
Right 1107873698 13:44770336-44770358 CTGAGCTAAGCCAAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107873698 Original CRISPR CTGAGCTAAGCCAAGTTGGA TGG Intergenic
No off target data available for this crispr