ID: 1107875672

View in Genome Browser
Species Human (GRCh38)
Location 13:44788810-44788832
Sequence GTTAGTCACATCAACACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107875672_1107875679 16 Left 1107875672 13:44788810-44788832 CCTGCTGTGTTGATGTGACTAAC No data
Right 1107875679 13:44788849-44788871 CAGTGTGATGCAGTCAGGGCTGG No data
1107875672_1107875675 11 Left 1107875672 13:44788810-44788832 CCTGCTGTGTTGATGTGACTAAC No data
Right 1107875675 13:44788844-44788866 GCACCCAGTGTGATGCAGTCAGG No data
1107875672_1107875676 12 Left 1107875672 13:44788810-44788832 CCTGCTGTGTTGATGTGACTAAC No data
Right 1107875676 13:44788845-44788867 CACCCAGTGTGATGCAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107875672 Original CRISPR GTTAGTCACATCAACACAGC AGG (reversed) Intergenic
No off target data available for this crispr