ID: 1107875675

View in Genome Browser
Species Human (GRCh38)
Location 13:44788844-44788866
Sequence GCACCCAGTGTGATGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107875672_1107875675 11 Left 1107875672 13:44788810-44788832 CCTGCTGTGTTGATGTGACTAAC No data
Right 1107875675 13:44788844-44788866 GCACCCAGTGTGATGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107875675 Original CRISPR GCACCCAGTGTGATGCAGTC AGG Intergenic
No off target data available for this crispr