ID: 1107875684

View in Genome Browser
Species Human (GRCh38)
Location 13:44788909-44788931
Sequence GGCACTGATGTGGTCTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107875684_1107875692 17 Left 1107875684 13:44788909-44788931 CCGGCCCAGACCACATCAGTGCC No data
Right 1107875692 13:44788949-44788971 CTGCTTGCTCTCCTGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107875684 Original CRISPR GGCACTGATGTGGTCTGGGC CGG (reversed) Intergenic
No off target data available for this crispr