ID: 1107881628

View in Genome Browser
Species Human (GRCh38)
Location 13:44837146-44837168
Sequence TTTCTAGCTGTGTCCCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107881625_1107881628 29 Left 1107881625 13:44837094-44837116 CCAGCGGACTTGGTGTCTGGGAA No data
Right 1107881628 13:44837146-44837168 TTTCTAGCTGTGTCCCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107881628 Original CRISPR TTTCTAGCTGTGTCCCTGCA TGG Intergenic
No off target data available for this crispr