ID: 1107888443

View in Genome Browser
Species Human (GRCh38)
Location 13:44893823-44893845
Sequence CGGGTGTCCTCCTTCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888443_1107888451 15 Left 1107888443 13:44893823-44893845 CCCAGGCAGAAGGAGGACACCCG No data
Right 1107888451 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
1107888443_1107888454 25 Left 1107888443 13:44893823-44893845 CCCAGGCAGAAGGAGGACACCCG No data
Right 1107888454 13:44893871-44893893 TCTACGTTGCAGGATTGACAGGG No data
1107888443_1107888446 -8 Left 1107888443 13:44893823-44893845 CCCAGGCAGAAGGAGGACACCCG No data
Right 1107888446 13:44893838-44893860 GACACCCGGTGCATTAGTGATGG No data
1107888443_1107888453 24 Left 1107888443 13:44893823-44893845 CCCAGGCAGAAGGAGGACACCCG No data
Right 1107888453 13:44893870-44893892 GTCTACGTTGCAGGATTGACAGG No data
1107888443_1107888449 -1 Left 1107888443 13:44893823-44893845 CCCAGGCAGAAGGAGGACACCCG No data
Right 1107888449 13:44893845-44893867 GGTGCATTAGTGATGGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888443 Original CRISPR CGGGTGTCCTCCTTCTGCCT GGG (reversed) Intergenic
No off target data available for this crispr