ID: 1107888444

View in Genome Browser
Species Human (GRCh38)
Location 13:44893824-44893846
Sequence CCGGGTGTCCTCCTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888444_1107888451 14 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888451 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
1107888444_1107888455 30 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data
1107888444_1107888449 -2 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888449 13:44893845-44893867 GGTGCATTAGTGATGGCCCTCGG No data
1107888444_1107888454 24 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888454 13:44893871-44893893 TCTACGTTGCAGGATTGACAGGG No data
1107888444_1107888453 23 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888453 13:44893870-44893892 GTCTACGTTGCAGGATTGACAGG No data
1107888444_1107888446 -9 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888446 13:44893838-44893860 GACACCCGGTGCATTAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888444 Original CRISPR CCGGGTGTCCTCCTTCTGCC TGG (reversed) Intergenic