ID: 1107888446

View in Genome Browser
Species Human (GRCh38)
Location 13:44893838-44893860
Sequence GACACCCGGTGCATTAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888444_1107888446 -9 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888446 13:44893838-44893860 GACACCCGGTGCATTAGTGATGG No data
1107888443_1107888446 -8 Left 1107888443 13:44893823-44893845 CCCAGGCAGAAGGAGGACACCCG No data
Right 1107888446 13:44893838-44893860 GACACCCGGTGCATTAGTGATGG No data
1107888439_1107888446 29 Left 1107888439 13:44893786-44893808 CCTGAGTCTTGATATAAACATTA No data
Right 1107888446 13:44893838-44893860 GACACCCGGTGCATTAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888446 Original CRISPR GACACCCGGTGCATTAGTGA TGG Intergenic
No off target data available for this crispr