ID: 1107888447

View in Genome Browser
Species Human (GRCh38)
Location 13:44893842-44893864
Sequence AGGGCCATCACTAATGCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888447_1107888453 5 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888453 13:44893870-44893892 GTCTACGTTGCAGGATTGACAGG No data
1107888447_1107888459 27 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888459 13:44893892-44893914 GGATCTGGACAGGAGGCAGGAGG No data
1107888447_1107888457 20 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888457 13:44893885-44893907 TTGACAGGGATCTGGACAGGAGG No data
1107888447_1107888458 24 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888458 13:44893889-44893911 CAGGGATCTGGACAGGAGGCAGG No data
1107888447_1107888455 12 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data
1107888447_1107888454 6 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888454 13:44893871-44893893 TCTACGTTGCAGGATTGACAGGG No data
1107888447_1107888456 17 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888456 13:44893882-44893904 GGATTGACAGGGATCTGGACAGG No data
1107888447_1107888451 -4 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888451 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888447 Original CRISPR AGGGCCATCACTAATGCACC GGG (reversed) Intergenic
No off target data available for this crispr