ID: 1107888448

View in Genome Browser
Species Human (GRCh38)
Location 13:44893843-44893865
Sequence GAGGGCCATCACTAATGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888448_1107888451 -5 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888451 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
1107888448_1107888453 4 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888453 13:44893870-44893892 GTCTACGTTGCAGGATTGACAGG No data
1107888448_1107888459 26 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888459 13:44893892-44893914 GGATCTGGACAGGAGGCAGGAGG No data
1107888448_1107888458 23 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888458 13:44893889-44893911 CAGGGATCTGGACAGGAGGCAGG No data
1107888448_1107888456 16 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888456 13:44893882-44893904 GGATTGACAGGGATCTGGACAGG No data
1107888448_1107888455 11 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data
1107888448_1107888457 19 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888457 13:44893885-44893907 TTGACAGGGATCTGGACAGGAGG No data
1107888448_1107888454 5 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888454 13:44893871-44893893 TCTACGTTGCAGGATTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888448 Original CRISPR GAGGGCCATCACTAATGCAC CGG (reversed) Intergenic
No off target data available for this crispr