ID: 1107888450

View in Genome Browser
Species Human (GRCh38)
Location 13:44893861-44893883
Sequence CCTGCAACGTAGACATCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888450_1107888459 8 Left 1107888450 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
Right 1107888459 13:44893892-44893914 GGATCTGGACAGGAGGCAGGAGG No data
1107888450_1107888455 -7 Left 1107888450 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data
1107888450_1107888458 5 Left 1107888450 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
Right 1107888458 13:44893889-44893911 CAGGGATCTGGACAGGAGGCAGG No data
1107888450_1107888456 -2 Left 1107888450 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
Right 1107888456 13:44893882-44893904 GGATTGACAGGGATCTGGACAGG No data
1107888450_1107888457 1 Left 1107888450 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
Right 1107888457 13:44893885-44893907 TTGACAGGGATCTGGACAGGAGG No data
1107888450_1107888460 25 Left 1107888450 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
Right 1107888460 13:44893909-44893931 AGGAGGTGAAGCATGCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888450 Original CRISPR CCTGCAACGTAGACATCCGA GGG (reversed) Intergenic