ID: 1107888454

View in Genome Browser
Species Human (GRCh38)
Location 13:44893871-44893893
Sequence TCTACGTTGCAGGATTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888443_1107888454 25 Left 1107888443 13:44893823-44893845 CCCAGGCAGAAGGAGGACACCCG No data
Right 1107888454 13:44893871-44893893 TCTACGTTGCAGGATTGACAGGG No data
1107888448_1107888454 5 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888454 13:44893871-44893893 TCTACGTTGCAGGATTGACAGGG No data
1107888444_1107888454 24 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888454 13:44893871-44893893 TCTACGTTGCAGGATTGACAGGG No data
1107888447_1107888454 6 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888454 13:44893871-44893893 TCTACGTTGCAGGATTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888454 Original CRISPR TCTACGTTGCAGGATTGACA GGG Intergenic
No off target data available for this crispr