ID: 1107888455

View in Genome Browser
Species Human (GRCh38)
Location 13:44893877-44893899
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888452_1107888455 -8 Left 1107888452 13:44893862-44893884 CCTCGGATGTCTACGTTGCAGGA No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data
1107888447_1107888455 12 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data
1107888444_1107888455 30 Left 1107888444 13:44893824-44893846 CCAGGCAGAAGGAGGACACCCGG No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data
1107888450_1107888455 -7 Left 1107888450 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data
1107888448_1107888455 11 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888455 13:44893877-44893899 TTGCAGGATTGACAGGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888455 Original CRISPR TTGCAGGATTGACAGGGATC TGG Intergenic