ID: 1107888459

View in Genome Browser
Species Human (GRCh38)
Location 13:44893892-44893914
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107888452_1107888459 7 Left 1107888452 13:44893862-44893884 CCTCGGATGTCTACGTTGCAGGA No data
Right 1107888459 13:44893892-44893914 GGATCTGGACAGGAGGCAGGAGG No data
1107888448_1107888459 26 Left 1107888448 13:44893843-44893865 CCGGTGCATTAGTGATGGCCCTC No data
Right 1107888459 13:44893892-44893914 GGATCTGGACAGGAGGCAGGAGG No data
1107888450_1107888459 8 Left 1107888450 13:44893861-44893883 CCCTCGGATGTCTACGTTGCAGG No data
Right 1107888459 13:44893892-44893914 GGATCTGGACAGGAGGCAGGAGG No data
1107888447_1107888459 27 Left 1107888447 13:44893842-44893864 CCCGGTGCATTAGTGATGGCCCT No data
Right 1107888459 13:44893892-44893914 GGATCTGGACAGGAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107888459 Original CRISPR GGATCTGGACAGGAGGCAGG AGG Intergenic