ID: 1107889927

View in Genome Browser
Species Human (GRCh38)
Location 13:44905317-44905339
Sequence CATATCCCTCACCCCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889927_1107889930 -8 Left 1107889927 13:44905317-44905339 CCTCCCTGGGGGTGAGGGATATG No data
Right 1107889930 13:44905332-44905354 GGGATATGCCGCTTCCATCAAGG No data
1107889927_1107889932 2 Left 1107889927 13:44905317-44905339 CCTCCCTGGGGGTGAGGGATATG No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889927_1107889934 21 Left 1107889927 13:44905317-44905339 CCTCCCTGGGGGTGAGGGATATG No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889927 Original CRISPR CATATCCCTCACCCCCAGGG AGG (reversed) Intergenic