ID: 1107889928 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:44905320-44905342 |
| Sequence | CGGCATATCCCTCACCCCCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1107889928_1107889932 | -1 | Left | 1107889928 | 13:44905320-44905342 | CCCTGGGGGTGAGGGATATGCCG | No data | ||
| Right | 1107889932 | 13:44905342-44905364 | GCTTCCATCAAGGCTCTCGATGG | No data | ||||
| 1107889928_1107889934 | 18 | Left | 1107889928 | 13:44905320-44905342 | CCCTGGGGGTGAGGGATATGCCG | No data | ||
| Right | 1107889934 | 13:44905361-44905383 | ATGGTCCTGCAAGAAACAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1107889928 | Original CRISPR | CGGCATATCCCTCACCCCCA GGG (reversed) | Intergenic | ||