ID: 1107889928

View in Genome Browser
Species Human (GRCh38)
Location 13:44905320-44905342
Sequence CGGCATATCCCTCACCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889928_1107889932 -1 Left 1107889928 13:44905320-44905342 CCCTGGGGGTGAGGGATATGCCG No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889928_1107889934 18 Left 1107889928 13:44905320-44905342 CCCTGGGGGTGAGGGATATGCCG No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889928 Original CRISPR CGGCATATCCCTCACCCCCA GGG (reversed) Intergenic