ID: 1107889929

View in Genome Browser
Species Human (GRCh38)
Location 13:44905321-44905343
Sequence GCGGCATATCCCTCACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889929_1107889934 17 Left 1107889929 13:44905321-44905343 CCTGGGGGTGAGGGATATGCCGC No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data
1107889929_1107889936 30 Left 1107889929 13:44905321-44905343 CCTGGGGGTGAGGGATATGCCGC No data
Right 1107889936 13:44905374-44905396 AAACAGTAGGCCAAAATGAGAGG No data
1107889929_1107889932 -2 Left 1107889929 13:44905321-44905343 CCTGGGGGTGAGGGATATGCCGC No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889929 Original CRISPR GCGGCATATCCCTCACCCCC AGG (reversed) Intergenic