ID: 1107889931

View in Genome Browser
Species Human (GRCh38)
Location 13:44905340-44905362
Sequence ATCGAGAGCCTTGATGGAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889931_1107889936 11 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889936 13:44905374-44905396 AAACAGTAGGCCAAAATGAGAGG No data
1107889931_1107889937 12 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889937 13:44905375-44905397 AACAGTAGGCCAAAATGAGAGGG No data
1107889931_1107889939 19 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889939 13:44905382-44905404 GGCCAAAATGAGAGGGAGGCTGG No data
1107889931_1107889941 24 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889941 13:44905387-44905409 AAATGAGAGGGAGGCTGGATAGG No data
1107889931_1107889938 15 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889938 13:44905378-44905400 AGTAGGCCAAAATGAGAGGGAGG No data
1107889931_1107889934 -2 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data
1107889931_1107889942 25 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889942 13:44905388-44905410 AATGAGAGGGAGGCTGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889931 Original CRISPR ATCGAGAGCCTTGATGGAAG CGG (reversed) Intergenic