ID: 1107889932

View in Genome Browser
Species Human (GRCh38)
Location 13:44905342-44905364
Sequence GCTTCCATCAAGGCTCTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889916_1107889932 25 Left 1107889916 13:44905294-44905316 CCTTTTCCCAGCCCTGGTCTGCT No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889923_1107889932 13 Left 1107889923 13:44905306-44905328 CCTGGTCTGCTCCTCCCTGGGGG No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889921_1107889932 14 Left 1107889921 13:44905305-44905327 CCCTGGTCTGCTCCTCCCTGGGG No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889915_1107889932 26 Left 1107889915 13:44905293-44905315 CCCTTTTCCCAGCCCTGGTCTGC No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889928_1107889932 -1 Left 1107889928 13:44905320-44905342 CCCTGGGGGTGAGGGATATGCCG No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889917_1107889932 19 Left 1107889917 13:44905300-44905322 CCCAGCCCTGGTCTGCTCCTCCC No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889929_1107889932 -2 Left 1107889929 13:44905321-44905343 CCTGGGGGTGAGGGATATGCCGC No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889927_1107889932 2 Left 1107889927 13:44905317-44905339 CCTCCCTGGGGGTGAGGGATATG No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data
1107889918_1107889932 18 Left 1107889918 13:44905301-44905323 CCAGCCCTGGTCTGCTCCTCCCT No data
Right 1107889932 13:44905342-44905364 GCTTCCATCAAGGCTCTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889932 Original CRISPR GCTTCCATCAAGGCTCTCGA TGG Intergenic