ID: 1107889933

View in Genome Browser
Species Human (GRCh38)
Location 13:44905346-44905368
Sequence AGGACCATCGAGAGCCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889933_1107889938 9 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889938 13:44905378-44905400 AGTAGGCCAAAATGAGAGGGAGG No data
1107889933_1107889941 18 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889941 13:44905387-44905409 AAATGAGAGGGAGGCTGGATAGG No data
1107889933_1107889936 5 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889936 13:44905374-44905396 AAACAGTAGGCCAAAATGAGAGG No data
1107889933_1107889937 6 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889937 13:44905375-44905397 AACAGTAGGCCAAAATGAGAGGG No data
1107889933_1107889939 13 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889939 13:44905382-44905404 GGCCAAAATGAGAGGGAGGCTGG No data
1107889933_1107889934 -8 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data
1107889933_1107889942 19 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889942 13:44905388-44905410 AATGAGAGGGAGGCTGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889933 Original CRISPR AGGACCATCGAGAGCCTTGA TGG (reversed) Intergenic
No off target data available for this crispr