ID: 1107889934

View in Genome Browser
Species Human (GRCh38)
Location 13:44905361-44905383
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889927_1107889934 21 Left 1107889927 13:44905317-44905339 CCTCCCTGGGGGTGAGGGATATG No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data
1107889933_1107889934 -8 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data
1107889929_1107889934 17 Left 1107889929 13:44905321-44905343 CCTGGGGGTGAGGGATATGCCGC No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data
1107889928_1107889934 18 Left 1107889928 13:44905320-44905342 CCCTGGGGGTGAGGGATATGCCG No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data
1107889931_1107889934 -2 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889934 13:44905361-44905383 ATGGTCCTGCAAGAAACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889934 Original CRISPR ATGGTCCTGCAAGAAACAGT AGG Intergenic