ID: 1107889935

View in Genome Browser
Species Human (GRCh38)
Location 13:44905366-44905388
Sequence TTTGGCCTACTGTTTCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889935_1107889945 14 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889945 13:44905403-44905425 GGATAGGGACGAGTTATGTGGGG No data
1107889935_1107889939 -7 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889939 13:44905382-44905404 GGCCAAAATGAGAGGGAGGCTGG No data
1107889935_1107889941 -2 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889941 13:44905387-44905409 AAATGAGAGGGAGGCTGGATAGG No data
1107889935_1107889944 13 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889944 13:44905402-44905424 TGGATAGGGACGAGTTATGTGGG No data
1107889935_1107889943 12 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889943 13:44905401-44905423 CTGGATAGGGACGAGTTATGTGG No data
1107889935_1107889946 23 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889946 13:44905412-44905434 CGAGTTATGTGGGGAAGTACTGG No data
1107889935_1107889942 -1 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889942 13:44905388-44905410 AATGAGAGGGAGGCTGGATAGGG 0: 1
1: 0
2: 3
3: 38
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889935 Original CRISPR TTTGGCCTACTGTTTCTTGC AGG (reversed) Intergenic