ID: 1107889936

View in Genome Browser
Species Human (GRCh38)
Location 13:44905374-44905396
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889931_1107889936 11 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889936 13:44905374-44905396 AAACAGTAGGCCAAAATGAGAGG No data
1107889929_1107889936 30 Left 1107889929 13:44905321-44905343 CCTGGGGGTGAGGGATATGCCGC No data
Right 1107889936 13:44905374-44905396 AAACAGTAGGCCAAAATGAGAGG No data
1107889933_1107889936 5 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889936 13:44905374-44905396 AAACAGTAGGCCAAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889936 Original CRISPR AAACAGTAGGCCAAAATGAG AGG Intergenic