ID: 1107889937

View in Genome Browser
Species Human (GRCh38)
Location 13:44905375-44905397
Sequence AACAGTAGGCCAAAATGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889931_1107889937 12 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889937 13:44905375-44905397 AACAGTAGGCCAAAATGAGAGGG No data
1107889933_1107889937 6 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889937 13:44905375-44905397 AACAGTAGGCCAAAATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889937 Original CRISPR AACAGTAGGCCAAAATGAGA GGG Intergenic