ID: 1107889939

View in Genome Browser
Species Human (GRCh38)
Location 13:44905382-44905404
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889931_1107889939 19 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889939 13:44905382-44905404 GGCCAAAATGAGAGGGAGGCTGG No data
1107889933_1107889939 13 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889939 13:44905382-44905404 GGCCAAAATGAGAGGGAGGCTGG No data
1107889935_1107889939 -7 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889939 13:44905382-44905404 GGCCAAAATGAGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889939 Original CRISPR GGCCAAAATGAGAGGGAGGC TGG Intergenic