ID: 1107889940

View in Genome Browser
Species Human (GRCh38)
Location 13:44905384-44905406
Sequence ATCCAGCCTCCCTCTCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889940_1107889949 25 Left 1107889940 13:44905384-44905406 CCAAAATGAGAGGGAGGCTGGAT No data
Right 1107889949 13:44905432-44905454 TGGAGCCCTTACAGTTCTAGGGG No data
1107889940_1107889943 -6 Left 1107889940 13:44905384-44905406 CCAAAATGAGAGGGAGGCTGGAT No data
Right 1107889943 13:44905401-44905423 CTGGATAGGGACGAGTTATGTGG No data
1107889940_1107889945 -4 Left 1107889940 13:44905384-44905406 CCAAAATGAGAGGGAGGCTGGAT No data
Right 1107889945 13:44905403-44905425 GGATAGGGACGAGTTATGTGGGG No data
1107889940_1107889948 24 Left 1107889940 13:44905384-44905406 CCAAAATGAGAGGGAGGCTGGAT No data
Right 1107889948 13:44905431-44905453 CTGGAGCCCTTACAGTTCTAGGG No data
1107889940_1107889946 5 Left 1107889940 13:44905384-44905406 CCAAAATGAGAGGGAGGCTGGAT No data
Right 1107889946 13:44905412-44905434 CGAGTTATGTGGGGAAGTACTGG No data
1107889940_1107889944 -5 Left 1107889940 13:44905384-44905406 CCAAAATGAGAGGGAGGCTGGAT No data
Right 1107889944 13:44905402-44905424 TGGATAGGGACGAGTTATGTGGG No data
1107889940_1107889947 23 Left 1107889940 13:44905384-44905406 CCAAAATGAGAGGGAGGCTGGAT No data
Right 1107889947 13:44905430-44905452 ACTGGAGCCCTTACAGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889940 Original CRISPR ATCCAGCCTCCCTCTCATTT TGG (reversed) Intergenic
No off target data available for this crispr