ID: 1107889942

View in Genome Browser
Species Human (GRCh38)
Location 13:44905388-44905410
Sequence AATGAGAGGGAGGCTGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889931_1107889942 25 Left 1107889931 13:44905340-44905362 CCGCTTCCATCAAGGCTCTCGAT No data
Right 1107889942 13:44905388-44905410 AATGAGAGGGAGGCTGGATAGGG No data
1107889935_1107889942 -1 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889942 13:44905388-44905410 AATGAGAGGGAGGCTGGATAGGG No data
1107889933_1107889942 19 Left 1107889933 13:44905346-44905368 CCATCAAGGCTCTCGATGGTCCT No data
Right 1107889942 13:44905388-44905410 AATGAGAGGGAGGCTGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889942 Original CRISPR AATGAGAGGGAGGCTGGATA GGG Intergenic
No off target data available for this crispr