ID: 1107889945

View in Genome Browser
Species Human (GRCh38)
Location 13:44905403-44905425
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107889940_1107889945 -4 Left 1107889940 13:44905384-44905406 CCAAAATGAGAGGGAGGCTGGAT No data
Right 1107889945 13:44905403-44905425 GGATAGGGACGAGTTATGTGGGG No data
1107889935_1107889945 14 Left 1107889935 13:44905366-44905388 CCTGCAAGAAACAGTAGGCCAAA No data
Right 1107889945 13:44905403-44905425 GGATAGGGACGAGTTATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107889945 Original CRISPR GGATAGGGACGAGTTATGTG GGG Intergenic
No off target data available for this crispr