ID: 1107892602

View in Genome Browser
Species Human (GRCh38)
Location 13:44927399-44927421
Sequence CTGTGTACACAGATGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107892602_1107892605 -5 Left 1107892602 13:44927399-44927421 CCATTGCCCATCTGTGTACACAG No data
Right 1107892605 13:44927417-44927439 CACAGTCTCTCATTTCCAAGAGG No data
1107892602_1107892606 -4 Left 1107892602 13:44927399-44927421 CCATTGCCCATCTGTGTACACAG No data
Right 1107892606 13:44927418-44927440 ACAGTCTCTCATTTCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107892602 Original CRISPR CTGTGTACACAGATGGGCAA TGG (reversed) Intergenic
No off target data available for this crispr