ID: 1107892605

View in Genome Browser
Species Human (GRCh38)
Location 13:44927417-44927439
Sequence CACAGTCTCTCATTTCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107892602_1107892605 -5 Left 1107892602 13:44927399-44927421 CCATTGCCCATCTGTGTACACAG No data
Right 1107892605 13:44927417-44927439 CACAGTCTCTCATTTCCAAGAGG No data
1107892601_1107892605 -1 Left 1107892601 13:44927395-44927417 CCAGCCATTGCCCATCTGTGTAC No data
Right 1107892605 13:44927417-44927439 CACAGTCTCTCATTTCCAAGAGG No data
1107892598_1107892605 24 Left 1107892598 13:44927370-44927392 CCAGAGCTCCATTTTTACATGTG No data
Right 1107892605 13:44927417-44927439 CACAGTCTCTCATTTCCAAGAGG No data
1107892600_1107892605 16 Left 1107892600 13:44927378-44927400 CCATTTTTACATGTGGTCCAGCC No data
Right 1107892605 13:44927417-44927439 CACAGTCTCTCATTTCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107892605 Original CRISPR CACAGTCTCTCATTTCCAAG AGG Intergenic
No off target data available for this crispr