ID: 1107892606

View in Genome Browser
Species Human (GRCh38)
Location 13:44927418-44927440
Sequence ACAGTCTCTCATTTCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107892601_1107892606 0 Left 1107892601 13:44927395-44927417 CCAGCCATTGCCCATCTGTGTAC No data
Right 1107892606 13:44927418-44927440 ACAGTCTCTCATTTCCAAGAGGG No data
1107892600_1107892606 17 Left 1107892600 13:44927378-44927400 CCATTTTTACATGTGGTCCAGCC No data
Right 1107892606 13:44927418-44927440 ACAGTCTCTCATTTCCAAGAGGG No data
1107892598_1107892606 25 Left 1107892598 13:44927370-44927392 CCAGAGCTCCATTTTTACATGTG No data
Right 1107892606 13:44927418-44927440 ACAGTCTCTCATTTCCAAGAGGG No data
1107892602_1107892606 -4 Left 1107892602 13:44927399-44927421 CCATTGCCCATCTGTGTACACAG No data
Right 1107892606 13:44927418-44927440 ACAGTCTCTCATTTCCAAGAGGG No data
1107892603_1107892606 -10 Left 1107892603 13:44927405-44927427 CCCATCTGTGTACACAGTCTCTC No data
Right 1107892606 13:44927418-44927440 ACAGTCTCTCATTTCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107892606 Original CRISPR ACAGTCTCTCATTTCCAAGA GGG Intergenic
No off target data available for this crispr