ID: 1107894396

View in Genome Browser
Species Human (GRCh38)
Location 13:44946388-44946410
Sequence CAAACTGATTTGGCTATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107894396_1107894402 -4 Left 1107894396 13:44946388-44946410 CCCATTATAGCCAAATCAGTTTG 0: 1
1: 0
2: 1
3: 10
4: 152
Right 1107894402 13:44946407-44946429 TTTGAGGAAACATAATTTTGGGG 0: 1
1: 0
2: 4
3: 54
4: 464
1107894396_1107894401 -5 Left 1107894396 13:44946388-44946410 CCCATTATAGCCAAATCAGTTTG 0: 1
1: 0
2: 1
3: 10
4: 152
Right 1107894401 13:44946406-44946428 GTTTGAGGAAACATAATTTTGGG 0: 1
1: 0
2: 2
3: 38
4: 363
1107894396_1107894400 -6 Left 1107894396 13:44946388-44946410 CCCATTATAGCCAAATCAGTTTG 0: 1
1: 0
2: 1
3: 10
4: 152
Right 1107894400 13:44946405-44946427 AGTTTGAGGAAACATAATTTTGG 0: 1
1: 0
2: 4
3: 33
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107894396 Original CRISPR CAAACTGATTTGGCTATAAT GGG (reversed) Intronic
902354768 1:15889551-15889573 CAAACTGAATTGGCTTCAAAGGG + Intronic
906390261 1:45409067-45409089 CAAACTGGCTTGGTTCTAATTGG + Intronic
907089138 1:51708102-51708124 TAAACGGATTTGGCTGTATTAGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907888533 1:58616559-58616581 CAAACTGAATTGCCTTTAATTGG - Intergenic
909523273 1:76593850-76593872 CATACTGATGTGGCGATCATAGG + Intronic
909736032 1:78962864-78962886 CAAACGGATTAGGATAAAATAGG + Intronic
912065079 1:105728585-105728607 CAAATTCATTTGAATATAATAGG + Intergenic
918257207 1:182759458-182759480 CATAATGATTTGGGTATAGTAGG - Intergenic
919489076 1:198182793-198182815 AAAACTGTGTTGGATATAATGGG + Intronic
1065757324 10:28943680-28943702 AAAATTGTTTTGGCTATTATAGG + Intergenic
1069034867 10:63636043-63636065 CAAACCTATTTGGCTGTACTTGG + Intergenic
1070371832 10:75789783-75789805 CAAACTGCTGTTGCTATATTTGG + Intronic
1073271763 10:102270774-102270796 CAAACTTTTATAGCTATAATTGG + Intronic
1074055745 10:109922080-109922102 CAAATTGATTTACCTAAAATGGG - Intronic
1075076007 10:119350724-119350746 CAAACAGCTTTTGCTGTAATGGG - Intronic
1079863363 11:25702983-25703005 AAAACTCATTTAGCTGTAATGGG + Intergenic
1081255875 11:40894047-40894069 CAAACTGAACCAGCTATAATTGG - Intronic
1081948539 11:47021450-47021472 CAAGTTGATATGGATATAATAGG - Intronic
1082929439 11:58585073-58585095 CAATCTGATTTGCCTTTATTAGG - Intronic
1088677851 11:112213551-112213573 AAAACTGCTTGGGCTATAGTAGG + Intronic
1089490321 11:118879307-118879329 CAAACTGAGTTGACTATCAAAGG + Intergenic
1089882922 11:121792205-121792227 AAAACTGATTTGGATGCAATTGG + Intergenic
1091032721 11:132205296-132205318 CATCCTGATTTGGATTTAATAGG + Intronic
1098050008 12:66443373-66443395 CCAACTGCTCTGGCTATATTTGG + Intronic
1099671851 12:85704400-85704422 CATACTGTTTTGGCAATAACAGG + Intergenic
1102130757 12:110526942-110526964 CATACTGATCTGGCCATAATTGG - Intronic
1103169409 12:118801667-118801689 AAAATTGTTTTGGCTATCATGGG + Intergenic
1106078706 13:26482853-26482875 GAAACTGCTTAGGCTATAAAGGG - Intergenic
1106988079 13:35379930-35379952 CAAATTGACTTGGCTATTCTTGG + Intronic
1107894396 13:44946388-44946410 CAAACTGATTTGGCTATAATGGG - Intronic
1107954604 13:45498799-45498821 CAAATTGTTTTGGCTATTTTGGG + Intronic
1110613574 13:77516328-77516350 CAAACTCATGTGGCTCTGATAGG + Intergenic
1112362179 13:98728156-98728178 AAAAATGAGTTGGCTATAAATGG + Intronic
1112414224 13:99190947-99190969 AAAACAGATTTGGCCATATTGGG - Intergenic
1113383414 13:109825170-109825192 CATACTGAATGGGCAATAATTGG - Intergenic
1114788768 14:25631882-25631904 CAAAATGATTTGCATATACTTGG + Intergenic
1115195151 14:30790550-30790572 CAAAATGTTTTGGCTATTTTTGG - Intergenic
1117177796 14:53162884-53162906 AAAACTCATTTAGCTCTAATGGG - Intergenic
1119915672 14:78398907-78398929 CACACTTGTTAGGCTATAATGGG - Intronic
1124797772 15:32799127-32799149 CAAACTGATTTGCCAAAAAATGG + Intronic
1125345087 15:38711163-38711185 CTAACTCACTTGTCTATAATGGG - Intergenic
1127495760 15:59510420-59510442 CAAACTGATGTGTCTAGACTTGG - Intronic
1127993733 15:64139545-64139567 CATACTGTTTTGGGCATAATGGG - Exonic
1128190202 15:65685984-65686006 CAAATTGTTTTGGCTATGCTGGG + Intronic
1128571381 15:68735727-68735749 CAATATTATTTGGCTATTATTGG + Intergenic
1130801465 15:87267801-87267823 AAAACTTAGTTGGCTATAGTTGG - Intergenic
1131474875 15:92729498-92729520 AAAATTGTTTTGGCTATTATAGG - Intronic
1137966661 16:52941316-52941338 AAAACTGATTTTTCCATAATGGG + Intergenic
1143796551 17:9341857-9341879 ATAACTGGTTTGGCTATAGTGGG + Intronic
1144375570 17:14636483-14636505 AAAACAGATTTGGCAATATTGGG + Intergenic
1148024897 17:44580179-44580201 CAAACAGATGTGGCACTAATAGG - Intergenic
1148513395 17:48192888-48192910 CAAACTCAGTTTGCTAAAATTGG + Intronic
1150998272 17:70344063-70344085 CAAACAGATTTGGGTCTAGTTGG - Intergenic
1152670392 17:81600801-81600823 CAAACAGGTTTGGCTAAATTAGG + Intronic
1154943264 18:21136009-21136031 AAAATTGTTTTGGCTATTATAGG + Intergenic
1154972729 18:21426997-21427019 AAAACTGTTTTGGCTATTCTGGG + Intronic
1157390071 18:47294290-47294312 GCAACTGATTTGTTTATAATAGG - Intergenic
1158628854 18:59094798-59094820 CAAACTGATCTAGCTACAATAGG + Intergenic
1160095437 18:75867741-75867763 GAAAATGATTTGATTATAATTGG + Intergenic
1163052007 19:14691392-14691414 CAAATTGAGTTGGCCATAAGTGG + Intronic
1166716773 19:44973436-44973458 CAAATTCATTTGGTTAAAATAGG + Intronic
926524665 2:13963368-13963390 CATGCTGATTTGGCTATTATGGG + Intergenic
927034634 2:19161665-19161687 CATACTGTTTTGGTTACAATAGG + Intergenic
928032081 2:27789023-27789045 AAAACTGTTTTGGCTATTCTAGG - Intronic
930450244 2:51526756-51526778 CAAACTGATTTTGCTAACTTGGG - Intergenic
937727702 2:125186784-125186806 CAAACCGCTTTGGCAATTATGGG - Intergenic
942883623 2:180894652-180894674 CAATTTGATTTGGAAATAATGGG + Intergenic
947405931 2:229777370-229777392 TAAACTGATCTGGCTACAACTGG + Exonic
947829968 2:233132685-233132707 CAAACTGCTTTGATTAGAATAGG + Intronic
948017898 2:234705001-234705023 CAAATTGCTTTGGCCATGATTGG + Intergenic
1172352565 20:34254866-34254888 AAATCTTATTTGGGTATAATAGG - Intronic
1174827999 20:53786337-53786359 CAAACGCATTAGGCTTTAATAGG + Intergenic
1178810883 21:35880163-35880185 AAAATTGTTCTGGCTATAATAGG - Intronic
1181382774 22:22520304-22520326 AAAAATGATTGGGCTATAAGGGG - Intergenic
1182147789 22:28007532-28007554 CAAGCTGATTTGGCTGAAGTTGG - Intronic
1183853789 22:40615428-40615450 TAAATTGTTTTGGCTATTATAGG + Intronic
949755131 3:7400499-7400521 TAGACTGATTTGACTACAATGGG - Intronic
951781656 3:26370036-26370058 CAAACTCATTTCTGTATAATAGG - Intergenic
952445967 3:33380891-33380913 CAACCTGAGCTGGGTATAATTGG + Intronic
953014784 3:39063447-39063469 CAAAGTGATTTGGCTAGTAGGGG + Intronic
953121002 3:40041837-40041859 CATACTGTTTTGGGCATAATGGG + Intronic
955301624 3:57785323-57785345 AAAACTGATTTGGGCATAAAAGG - Intronic
957889023 3:86330918-86330940 CCTACTGATTTGGCTGCAATTGG - Intergenic
958662797 3:97093093-97093115 CAAACTTATTTGGATAGAAATGG + Intronic
959211228 3:103384400-103384422 CAAACTGCTTTGGAAATATTGGG - Intergenic
959468304 3:106717719-106717741 GATACTGATTTGGCTGCAATAGG + Intergenic
964174404 3:153808503-153808525 CAATCTGGTTTGTCTAAAATAGG + Intergenic
966107608 3:176356046-176356068 TAAACTGATATGACTATAATGGG - Intergenic
966195352 3:177308555-177308577 AAAACTGCTTTGGCTAAAATGGG - Intergenic
967568574 3:191000447-191000469 CAAACTTATTTGGCTCTTAATGG - Intergenic
971084504 4:23256203-23256225 AAAACTGATTTTGCTATTCTAGG + Intergenic
973038102 4:45433427-45433449 CAAAATGTTTTGGCTGTAGTGGG - Intergenic
975347021 4:73303546-73303568 CAAGGTGATTTGGCTACACTGGG + Intergenic
975715215 4:77199083-77199105 CAGCCTGATTTAGGTATAATAGG - Intronic
980924850 4:139125752-139125774 CAGACTGATTTGGCTTTGCTGGG - Intronic
981673722 4:147316445-147316467 CAATTTGATTTGGATAAAATTGG - Intergenic
983758736 4:171377620-171377642 CAAACTTAATTGGCTATTCTTGG + Intergenic
984560869 4:181268178-181268200 CAAATTGATTTGTGTCTAATTGG + Intergenic
984872371 4:184337764-184337786 AAAACTGTTTTGGCTATTTTAGG - Intergenic
985873033 5:2573431-2573453 AAAATTGAGTTGGATATAATAGG - Intergenic
989780495 5:45258679-45258701 CAAACCTATTTTGTTATAATAGG + Intergenic
991434898 5:66587800-66587822 CAAAATGATTTGACTTTAAAAGG - Intergenic
994242311 5:97438773-97438795 GAAATTTATTTGGCTAAAATTGG - Intergenic
994909040 5:105877975-105877997 CAAACGTATTTGACTATGATCGG + Intergenic
995206196 5:109484135-109484157 CAAACTCAAGTGGCTAAAATTGG + Intergenic
997058906 5:130477977-130477999 CAAACTGCTTTAGCTATAACTGG - Intergenic
998595535 5:143526077-143526099 CAAAGTTATTTGGCTAGAAAAGG - Intergenic
1000798822 5:165698470-165698492 CAAACAGATTTCCCAATAATAGG + Intergenic
1002555259 5:180032779-180032801 CAAAATGCTTTGGCTATTCTAGG + Intronic
1005041401 6:21603522-21603544 CAATCTCATTAGGATATAATGGG - Intergenic
1005853963 6:29846483-29846505 AAAAGTGATTTTCCTATAATAGG + Intergenic
1007206380 6:40155109-40155131 CAAACTGTTTTGGTTATTGTGGG + Intergenic
1010345568 6:74806259-74806281 CCATCTGGTTTGGCTTTAATAGG - Intergenic
1010456312 6:76059854-76059876 TAAACTGATCTGGGTACAATGGG + Intronic
1012543467 6:100390553-100390575 CAAACTGCTTTGGCTCTCACCGG - Exonic
1014355414 6:120402984-120403006 AAAACTGATTTGGCTCTTTTGGG + Intergenic
1014659497 6:124150211-124150233 AAAATTGTTTTGGCTATTATCGG + Intronic
1015573418 6:134645669-134645691 GAAACTGATTAGGCCAAAATAGG - Intergenic
1016095140 6:140027638-140027660 TATACTCCTTTGGCTATAATGGG + Intergenic
1017574922 6:155791634-155791656 CATACTGATTTGGGTATTGTCGG - Intergenic
1017667160 6:156731287-156731309 CAAACTGATATACATATAATGGG + Intergenic
1020895551 7:13934345-13934367 GAAACTCATTTTGCTATAAAGGG - Intronic
1020994536 7:15246252-15246274 CAAACTGAATAGGCTGTATTTGG + Intronic
1021218802 7:17950136-17950158 CAAATTGATTTGCCTGTTATTGG - Intergenic
1021901240 7:25287939-25287961 AACACTGATTTGGCCATAACGGG - Intergenic
1022623530 7:32010178-32010200 AAAATTGATTTGGCTATTTTAGG - Intronic
1023194452 7:37618843-37618865 CAAGTTGTTTTGGCTATTATAGG + Intergenic
1023692316 7:42802831-42802853 CAAAGTAATTTTGCTATAGTTGG - Intergenic
1024616165 7:51114262-51114284 CACACTGATTTGCCTTTGATGGG - Intronic
1028358356 7:89936989-89937011 AAAATTGTTTTGGCTATACTAGG + Intergenic
1029297232 7:99551148-99551170 AGAAGTGATTTGGATATAATAGG - Intronic
1029593117 7:101520358-101520380 CAAAATGATTTGGCTATAAAAGG - Intronic
1030934536 7:115568838-115568860 CAAACTGATTTGGTCATTCTTGG - Intergenic
1031133053 7:117855411-117855433 AAAACTGATTTTGCTAAAATTGG - Intronic
1031309816 7:120181875-120181897 TTAACTCATTTTGCTATAATTGG - Intergenic
1031502820 7:122542209-122542231 CACAGTGATGAGGCTATAATTGG + Intronic
1039189785 8:34960218-34960240 CAAACTGATATTGCTTTAGTAGG + Intergenic
1039294641 8:36137178-36137200 CTAACTGGTTTGGCTTGAATTGG - Intergenic
1039591211 8:38750965-38750987 CAAAACGATGTGGCTATACTAGG - Intronic
1039651451 8:39343937-39343959 CAAATTGTTTTGGCTATTCTAGG + Intergenic
1042407845 8:68425701-68425723 AAAACTGTTTTGGCTATTCTAGG - Intronic
1042557999 8:70050044-70050066 CAAGCTGATTTGCCTCTAAGAGG - Intergenic
1043493190 8:80770298-80770320 TAAGTCGATTTGGCTATAATAGG - Intronic
1045832482 8:106480314-106480336 GAAAATGAAATGGCTATAATAGG - Intronic
1046343016 8:112883259-112883281 CATATTTATTTGGCTATTATAGG - Intronic
1046775606 8:118160377-118160399 AAAATTGATTTGGCTAATATAGG - Intergenic
1048246988 8:132816123-132816145 CAAACACATTTGACTAGAATAGG - Intronic
1048907266 8:139100213-139100235 CTAACTGATTTGGGTTGAATAGG + Intergenic
1050208894 9:3231463-3231485 CAAATTGATCTGACTAGAATTGG - Intronic
1052740010 9:32384279-32384301 AAAAATGATTTGGCCATAACTGG - Intergenic
1054753032 9:68928260-68928282 CATACTGTTTTGGCTATTCTGGG + Intronic
1055019306 9:71652070-71652092 GAAAATGATTTGGGTATCATGGG + Intergenic
1059398874 9:114056210-114056232 GAAACTGATTTGGCTGTAAATGG - Exonic
1062365597 9:136207424-136207446 AAATTTGATTTGGCTAAAATAGG - Exonic
1188030762 X:25260962-25260984 CAAACTGTTTTTTCTATAAAGGG - Intergenic
1188688501 X:33099743-33099765 CAATCTGTTTTGCCTTTAATGGG - Intronic
1189699685 X:43705129-43705151 AAAACTGCTTTGGCTATTATGGG - Intronic
1190785252 X:53640838-53640860 CAAACTGTTTTTGGTATAAGTGG - Intronic
1193753496 X:85377389-85377411 CAAACTGAGTTGGATATCAAAGG - Intronic
1197845890 X:130802199-130802221 CAAAATGATTTGGCTCAAAATGG + Intronic
1201391638 Y:13503531-13503553 CAACCTGCTTTAGCTACAATTGG + Intergenic
1201899216 Y:19030371-19030393 AAAACTGTTTTGGCTATTCTGGG + Intergenic
1202093526 Y:21219356-21219378 AAAACAGATTTGGCTATTCTGGG - Intergenic