ID: 1107895078

View in Genome Browser
Species Human (GRCh38)
Location 13:44953784-44953806
Sequence TATACCTAGCACTCTAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107895078_1107895081 25 Left 1107895078 13:44953784-44953806 CCACAATTAGAGTGCTAGGTATA 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1107895081 13:44953832-44953854 ACTATACTTGACTTACCTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 79
1107895078_1107895082 26 Left 1107895078 13:44953784-44953806 CCACAATTAGAGTGCTAGGTATA 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1107895082 13:44953833-44953855 CTATACTTGACTTACCTAAAGGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107895078 Original CRISPR TATACCTAGCACTCTAATTG TGG (reversed) Intronic
908901812 1:68964432-68964454 TATAACTAGCACTGTGATTTTGG + Intergenic
910489728 1:87755862-87755884 TCTACCTAGCTTTCAAATTGGGG - Intergenic
911903892 1:103540437-103540459 TATGCCTAGCACTCTTGTAGAGG + Intronic
915398256 1:155602547-155602569 ACTACCTAGCACTCAAATTCTGG - Intergenic
917072948 1:171172596-171172618 TATAACTAGTACATTAATTGTGG - Intergenic
918822693 1:189276445-189276467 TATACCTAGGAGTTTAATTGTGG - Intergenic
922493466 1:226037353-226037375 TATACCTAGGAGTGGAATTGCGG - Intergenic
1068133555 10:52926323-52926345 TATACTTAGCACACTAATGCAGG - Intergenic
1078956156 11:16197422-16197444 TATACTCAGCACTGTAATTCAGG - Intronic
1079728828 11:23914464-23914486 TATATCTAGCAGTGAAATTGTGG + Intergenic
1080161903 11:29186406-29186428 TATAGCTAGTGTTCTAATTGAGG + Intergenic
1080971919 11:37287878-37287900 TACAGCTAGCACTCTAGTTTGGG - Intergenic
1087885564 11:103477864-103477886 TATTCCTAGCACCCAAATTATGG + Intronic
1088238224 11:107747875-107747897 AATAGCTAGGACACTAATTGGGG - Intergenic
1093909613 12:24731174-24731196 TATTCCTAGCTCTTAAATTGAGG - Intergenic
1096989778 12:55790828-55790850 TATAGCTAGCAGTGGAATTGTGG - Intronic
1098088889 12:66879844-66879866 TATAACTAGCACTATAATAAAGG + Intergenic
1098096183 12:66958566-66958588 TATACCTAGGACCCAAATTTTGG - Intergenic
1105426479 13:20299094-20299116 TCTACCTAGAACTCTAATTTTGG + Intergenic
1107306747 13:39029755-39029777 CATACTTAGCCCTCTAACTGAGG - Intronic
1107895078 13:44953784-44953806 TATACCTAGCACTCTAATTGTGG - Intronic
1109509919 13:63357483-63357505 TATATCTATCACTGTGATTGTGG + Intergenic
1111352989 13:87057496-87057518 TATAATTAGCAATCTAATTTTGG + Intergenic
1115972250 14:38958731-38958753 TATACATAGCAATCTATCTGGGG - Intergenic
1117241297 14:53836740-53836762 TTAACCTAGCTCTCTAAGTGTGG - Intergenic
1117967856 14:61223895-61223917 TATAGCTAGCATACTAAATGAGG - Intronic
1118312024 14:64700972-64700994 TATAGCTAGCAGTGAAATTGTGG + Intergenic
1124090357 15:26593816-26593838 TATACCTAGAAGTGGAATTGTGG + Intronic
1124634841 15:31358692-31358714 TAAACCTGGCTCTGTAATTGTGG + Intronic
1127750732 15:62039839-62039861 TATACCTAGCAGTGGGATTGGGG - Intronic
1128825457 15:70711610-70711632 TATATCTAGCACTGTAAATGGGG - Intronic
1153081234 18:1227708-1227730 TATACCTAGGAGTGAAATTGAGG + Intergenic
1153356026 18:4136254-4136276 TATACCTAGCAGTGAGATTGTGG + Intronic
1153584581 18:6608045-6608067 TATACCTAGCATTCAAATTAAGG - Intergenic
1153863625 18:9239869-9239891 TGTACGTAGCATTCTAAATGTGG + Intronic
1157369322 18:47095857-47095879 TTTGCCTAGCACTCCAATTGAGG - Intronic
1157858799 18:51123309-51123331 TATCCCTAGCACCCTGACTGGGG - Intergenic
1164175052 19:22765365-22765387 TATACACTGCACTCTATTTGTGG - Intronic
1164926513 19:32134130-32134152 TATACCTAGGACTGAATTTGCGG - Intergenic
1167751723 19:51384741-51384763 CATCCCTAGCACACTAATTCAGG + Intronic
927261909 2:21100436-21100458 TATACCTAGGAGTGAAATTGCGG + Intergenic
928379394 2:30804607-30804629 TATACATAGAACACTAATTTTGG - Intronic
929373990 2:41261712-41261734 TTTAGATAGCACTCTAATTCAGG - Intergenic
930053505 2:47234970-47234992 TAGACCTAGCACTTCATTTGCGG - Intergenic
932543682 2:72684450-72684472 TATACCTAGCAGTGGAATTCTGG - Intronic
940579478 2:155559467-155559489 TATCCTTAGCAATCTAATTCAGG + Intergenic
943833994 2:192495898-192495920 AGTACATAGCACTCTTATTGTGG - Intergenic
947377152 2:229508299-229508321 TATACCTAGAAGTAAAATTGTGG - Intronic
1169309592 20:4523876-4523898 TATATCTAGTAGTGTAATTGTGG - Intergenic
1173738961 20:45382389-45382411 TATACCTAGAAGTGGAATTGTGG + Intronic
1176957439 21:15122318-15122340 TGTACTTAGCATTTTAATTGAGG - Intergenic
1181900123 22:26146945-26146967 TATACCCAGCATTCTTATTCTGG - Intergenic
952016208 3:28959730-28959752 TATACCTAGGAATGAAATTGCGG + Intergenic
956024232 3:64965294-64965316 TATACCTAGCAATGGATTTGTGG + Intergenic
960146276 3:114207251-114207273 TATACCTAGCAGTGCAGTTGCGG + Intergenic
960492038 3:118328848-118328870 CATACTTAGCATTCTAATAGTGG + Intergenic
965252971 3:166366808-166366830 TATACCAAGCACTGGGATTGTGG + Intergenic
965265865 3:166542524-166542546 CATACCTAGGAATCGAATTGTGG - Intergenic
966435394 3:179878079-179878101 TATACTTAACAGTCTAATGGAGG + Intronic
972956478 4:44398804-44398826 TTTACTGAGCACTCTATTTGTGG + Intronic
973941055 4:55911019-55911041 TAAACCTTGCAATCTAAGTGTGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
978661458 4:111131899-111131921 TATACCCAGCAGTGGAATTGTGG + Intergenic
978684871 4:111428421-111428443 TATACCTAGCAGTGGGATTGTGG - Intergenic
980275036 4:130639825-130639847 TATACTTAGAACTGTATTTGTGG - Intergenic
982425933 4:155260229-155260251 TATATCAAGCAGTATAATTGTGG - Intergenic
982590517 4:157303373-157303395 TTTACTTAGCATTCTATTTGTGG - Intronic
992892558 5:81217460-81217482 TATACCTACCATTCTCATTTTGG - Exonic
994159582 5:96541975-96541997 AATACCTAGCAGTGCAATTGCGG + Intronic
997126353 5:131231221-131231243 TAAACCTAGTACTTTAAATGAGG + Intergenic
997638244 5:135430912-135430934 TATACCTAGAAGTGAAATTGCGG - Intergenic
999076890 5:148804878-148804900 TATACATAGCACCCAGATTGAGG - Intergenic
1003515460 6:6814683-6814705 TAAAACCAGCACTCTAACTGTGG + Intergenic
1003907498 6:10715550-10715572 TATACCTAGAAGTAAAATTGCGG + Intergenic
1004117458 6:12783759-12783781 TAGACATAGCACTCAAATTTAGG + Intronic
1006250804 6:32782039-32782061 TATCCCTAGCAAACTAATGGGGG - Intergenic
1007022153 6:38531544-38531566 TATAACAAACACTGTAATTGTGG + Intronic
1008694099 6:54013946-54013968 TATACCTAGCAGTGGAATTTTGG + Intronic
1010848485 6:80742792-80742814 TATTTCTAGAACTCTAACTGGGG + Intergenic
1011572857 6:88758624-88758646 TATACCTAGCATTCTGACTATGG - Intronic
1018130434 6:160725985-160726007 GATATCTCCCACTCTAATTGTGG - Intronic
1018626826 6:165787987-165788009 TATACATCACACTCTCATTGAGG - Intronic
1021249078 7:18302251-18302273 TATGCTTAGTTCTCTAATTGTGG + Intronic
1022624606 7:32022082-32022104 TATACCAAACACTGTAATAGGGG - Intronic
1028022027 7:85789224-85789246 TTTACCTATCACTCAAACTGTGG - Intergenic
1033765419 7:144484455-144484477 TATACCTAGGAGTGGAATTGCGG - Intronic
1033938759 7:146623755-146623777 AATACCTAGCATTTTAATTGTGG + Intronic
1040363467 8:46689898-46689920 TATACCTAGCAGTGGGATTGTGG + Intergenic
1041604571 8:59765458-59765480 TCTACTTAACACTATAATTGAGG + Intergenic
1043539859 8:81248807-81248829 TATACCTAGCAGTGAAATTATGG - Intergenic
1043755096 8:83993716-83993738 TATATTTAGCACTCTCATTTAGG + Intergenic
1046391181 8:113574789-113574811 AATACCTAGGAGTCTGATTGTGG + Intergenic
1048203422 8:132396005-132396027 ATTACCTAGTACTCTAATTTCGG + Intronic
1051916326 9:22212315-22212337 TATAACTAATACTGTAATTGTGG + Intergenic
1052646838 9:31247117-31247139 TATCCCTAGCAAACTAATGGGGG - Intergenic
1052646958 9:31249073-31249095 TATCCCTAGCAAACTAATGGGGG - Intergenic
1061186119 9:129054852-129054874 TATACCTAGGAGTGAAATTGCGG + Intronic
1185939588 X:4300841-4300863 TATACCCAGCAGTGGAATTGCGG + Intergenic
1186858113 X:13645242-13645264 TATACCTAGCAGTGGAATTCTGG - Intergenic
1187574157 X:20536694-20536716 TATAACTAGTACACTGATTGGGG - Intergenic
1196358612 X:114825184-114825206 TTTGCCTAGCACTTTAATTTTGG + Intronic
1196943764 X:120803758-120803780 TATCCCTAGCAATCTAATACAGG - Intergenic
1197297568 X:124737764-124737786 TACAAGTAGCACTCTAGTTGGGG - Intronic
1197429407 X:126342257-126342279 TATATCTAGAAATCTCATTGAGG - Intergenic
1198225330 X:134640087-134640109 TATACCTAGAAGTGGAATTGTGG + Intronic
1198869953 X:141167454-141167476 TATACCGAGCACTGGACTTGTGG + Intergenic
1199030437 X:142992412-142992434 TATACCTAGAAGTGTAATTGTGG - Intergenic
1199223567 X:145344766-145344788 TATACTTAGCAAACTAATTCAGG + Intergenic
1199914271 X:152321974-152321996 TATACCTAGGAGTGGAATTGTGG - Intronic
1200930305 Y:8690979-8691001 TATTCCTGGGACTGTAATTGAGG + Intergenic