ID: 1107895302

View in Genome Browser
Species Human (GRCh38)
Location 13:44956052-44956074
Sequence AGAATGGTGTGAACCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107895294_1107895302 4 Left 1107895294 13:44956025-44956047 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1107895296_1107895302 3 Left 1107895296 13:44956026-44956048 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1107895292_1107895302 12 Left 1107895292 13:44956017-44956039 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107895302 Original CRISPR AGAATGGTGTGAACCCCAGG GGG Intronic
Too many off-targets to display for this crispr