ID: 1107897042

View in Genome Browser
Species Human (GRCh38)
Location 13:44975534-44975556
Sequence TTGTGGGGATGGAGAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 669}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107897042 Original CRISPR TTGTGGGGATGGAGAGAACT AGG (reversed) Intronic
900363613 1:2301559-2301581 TTATGGGGATGGAGGGCCCTGGG - Intronic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900750521 1:4394069-4394091 ATGTGGGTATGGAGGGTACTTGG + Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
902128046 1:14233907-14233929 TGGAGGGGATGTAGAGAAATAGG + Intergenic
902527254 1:17067325-17067347 CTCTGGGGCTGGAGAGATCTGGG + Exonic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903609239 1:24597966-24597988 TGGTGGGGGTGGGGGGAACTTGG + Intronic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904274799 1:29374128-29374150 TTTTGGGAATGGTGAGAAATAGG + Intergenic
905309943 1:37042408-37042430 CTCTGGGGATGGGGAGATCTTGG - Intergenic
905603300 1:39272681-39272703 TTTTTAGGATGGAGAGAAATGGG + Intronic
905624352 1:39477647-39477669 AGGTGGTGATGGAGAGAGCTAGG + Intronic
906224440 1:44109762-44109784 TTTCAGGGAGGGAGAGAACTGGG + Intergenic
906466350 1:46083788-46083810 TGGTGAGGATGTAGAGAAATTGG + Intronic
906654652 1:47538916-47538938 TTGGGGGGATGGAGAGCATCAGG + Intergenic
907178402 1:52547385-52547407 TAGTGAGGATGTAGAGAAATTGG + Intronic
907234560 1:53033677-53033699 TTGTGAGGATGTGGAGAAATTGG + Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907900970 1:58741114-58741136 TTGGGCTGATGGACAGAACTTGG + Intergenic
908088912 1:60665801-60665823 ATTTGGGGATGGAGAGCACTAGG + Intergenic
909404784 1:75275932-75275954 ATGTGGGGAGGGAGATAGCTGGG - Intronic
911426219 1:97716612-97716634 GTGTGGTGATGGAGGGATCTAGG - Intronic
911509944 1:98799173-98799195 TGGTGAGGATGGAGAGAAAGAGG - Intergenic
912420429 1:109539046-109539068 TTGTGGGACTGGACAGAGCTAGG - Intergenic
912524939 1:110275367-110275389 TGGTGAGGATGCAGAGAACAAGG + Intronic
912663772 1:111560840-111560862 TTGGGAGGATGGAGAGAAATTGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913429475 1:118775101-118775123 TGGTGAGGATGAAGAGAACTTGG - Intergenic
914218911 1:145659568-145659590 TGGTGGGGATGTGGAGAAATTGG - Intronic
914221350 1:145684780-145684802 GGGTGGGGATGAAGAGAGCTAGG - Intronic
914471494 1:147982443-147982465 TGGTGGGGATGTGGAGAAATTGG - Intronic
914473916 1:148007647-148007669 GGGTGGGGATGAAGAGAGCTAGG - Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
916079484 1:161223518-161223540 TTGTGGAGAGGGAGAGAGCCAGG - Intronic
916328530 1:163591115-163591137 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
916522467 1:165577068-165577090 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
917675563 1:177315993-177316015 TTGTGGGGAGGGAGAGCATCAGG + Intergenic
918126119 1:181585578-181585600 ATGTGGGGAAAAAGAGAACTTGG + Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918422510 1:184378347-184378369 TTGTGAGGATGCAGAGAAATGGG + Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919272332 1:195363931-195363953 TTGTGAGGATGTAGAGAAAAGGG + Intergenic
919363442 1:196624978-196625000 TTGTTGGGATAGAAAGAAGTTGG + Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919891506 1:201978710-201978732 TGGTGTGGATGGACATAACTTGG - Intergenic
920167559 1:204046331-204046353 CTTAGGGGAGGGAGAGAACTTGG + Intergenic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920626087 1:207601550-207601572 TGGTGAGGATGTAGAGAAATTGG - Intronic
921363576 1:214353074-214353096 TTGGGGGGATGGAGGGTACAGGG - Exonic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923007464 1:230062964-230062986 TGGTGAGGATGTAGAGAAATTGG - Intronic
923850620 1:237790335-237790357 CTGTGGAGATGGCAAGAACTGGG - Intronic
924001506 1:239558117-239558139 TTGTGAGGTTGCAGAGAAATAGG - Intronic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
924487492 1:244499977-244499999 TGGTGAGGATGCAGAGAAATAGG - Intronic
1062933935 10:1371818-1371840 TTGTGTGGATGCAGAGAAAAGGG + Intronic
1063842687 10:10089798-10089820 ATGTGGGGAGGGAGAGTATTAGG - Intergenic
1064564292 10:16624420-16624442 TAGTTGGGATGGCTAGAACTGGG - Intronic
1065386779 10:25142036-25142058 TTGTGGGGAAGGAGTAAAATAGG - Intergenic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065990072 10:31000454-31000476 TTGTGGGGGTAGAGAGAAAAAGG - Intronic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1067262979 10:44710640-44710662 TGGTGAGGATGTAGAGAACCCGG - Intergenic
1067290263 10:44934892-44934914 TTGGGGGGCTGGAGGGCACTGGG - Exonic
1067665092 10:48270861-48270883 TGGTGGGGTTGGAGAGAAACAGG - Intronic
1067821648 10:49536296-49536318 TTGGGGGTAGGGAGAGAACTAGG + Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067902520 10:50256994-50257016 TTGTGGATATGAAAAGAACTGGG + Intergenic
1068077481 10:52274814-52274836 TGGTGTGGATGGAGTGAACAGGG - Intronic
1068152138 10:53146019-53146041 TGGTGAGGATGTAGAGAAATAGG - Intergenic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1068379607 10:56234037-56234059 TAGTGGAAATGGAGATAACTGGG - Intergenic
1068559716 10:58500074-58500096 ATGTTGGGATGGAGAGAATTAGG - Intergenic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1069789663 10:71011573-71011595 TTGTTGTCATGGTGAGAACTGGG + Intergenic
1070372609 10:75797950-75797972 TTGGGGGGATGTAGAGAAATTGG - Intronic
1071067263 10:81650741-81650763 TTGTGGGGTTAGAGAGATGTTGG - Intergenic
1071090901 10:81917003-81917025 TTTTGGGGTTGGATAAAACTGGG - Intronic
1071337294 10:84611399-84611421 GTGTGGGGAGGGAGAGCATTAGG + Intergenic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1072755104 10:98014805-98014827 TGGTGAGGATGTAGAGAAATTGG + Intronic
1072948314 10:99830564-99830586 TTGTGGGGATGGGGAAAGATCGG + Intronic
1073856935 10:107687151-107687173 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1073866255 10:107807810-107807832 TTGTGGTGATGGTGAGATTTAGG + Intergenic
1074158209 10:110816351-110816373 TGGTGGGGAGGGAGAGGAATGGG - Intronic
1074370800 10:112899302-112899324 GTGTGGTTAGGGAGAGAACTGGG - Intergenic
1074924850 10:118057555-118057577 TTGGGTGGAGGGAGAGAGCTAGG + Intergenic
1075383352 10:122036914-122036936 TGGTGAGGATGTAGAGAAATTGG - Intronic
1076586207 10:131549319-131549341 GTGTGAGGATGGAGGGAACGGGG + Intergenic
1076619778 10:131779781-131779803 TCGTGGAGATGGAGAGGCCTTGG - Intergenic
1076734852 10:132454150-132454172 TTGTGGAGTTGGAGAGAGTTAGG - Intergenic
1077204250 11:1334462-1334484 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1078367618 11:10719832-10719854 TTGTGAGGCTGGAGACAGCTGGG - Intergenic
1078617956 11:12882403-12882425 TTGTGGGGAAGGAGACAGGTAGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1080461551 11:32459132-32459154 TGGTGGGGCTGGTGAGATCTTGG - Intergenic
1081020146 11:37936464-37936486 TGGAGGGGAGGGAGAGCACTAGG - Intergenic
1081394362 11:42567852-42567874 TTGTGGGGAGGGAGAGCATCAGG + Intergenic
1081680663 11:45000120-45000142 ATGTGTGGAGGGAGAGATCTGGG + Intergenic
1081974782 11:47226244-47226266 TGGTGGGGAAGTAGAGAAGTTGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083254479 11:61487713-61487735 TGGTGGGCATGGAAAGAACAGGG + Intronic
1083325727 11:61872078-61872100 TTCTGGGGCAGGAGAGCACTGGG - Intergenic
1083795912 11:65016588-65016610 TTGCTGAGATGGAGAGGACTGGG + Intronic
1085302579 11:75467154-75467176 TTGTGGAGATGGAAAGAGCACGG + Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085440849 11:76561154-76561176 TTGTGAGAATGAAGAGAAATAGG - Intergenic
1085551559 11:77378090-77378112 TTGTTGGGAAGGTGAGAACCAGG - Intronic
1085860766 11:80232454-80232476 TTGTGTGGATGTGGAGAACAGGG + Intergenic
1086052953 11:82615636-82615658 TTGTTGAAATGGAGAAAACTAGG - Intergenic
1086133405 11:83423052-83423074 TTTTGGGGGTGGACAGAAGTTGG - Intergenic
1087583499 11:100089899-100089921 TAGAGGGGAGGGAGAGAATTGGG + Intronic
1088044411 11:105430472-105430494 TTGGGGGGATGGAGAGGATGGGG - Intergenic
1088324404 11:108586745-108586767 TTGTTGGGGTGCAGAGAATTTGG + Intronic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1088705108 11:112455113-112455135 TTGTGGGGATGTAGAGCAACTGG - Intergenic
1088875124 11:113929148-113929170 TGGTGAGGATGGGGAGAAATTGG - Intronic
1089070245 11:115694408-115694430 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089626885 11:119756558-119756580 TGGTGAGGATGTAGAGAACTTGG + Intergenic
1090093837 11:123724615-123724637 TTGTGGGAGTGGCAAGAACTGGG - Exonic
1090606441 11:128426863-128426885 TTGAGAGGATGTAGAGAAATAGG - Intergenic
1090610556 11:128467095-128467117 TTGTGGGGAGCAAGAGAACTAGG + Intronic
1091300477 11:134504054-134504076 TTGGGGGGATGGAGTGGGCTTGG + Intergenic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1093069993 12:14698807-14698829 TGGTTGGAGTGGAGAGAACTAGG + Intergenic
1093136185 12:15454209-15454231 TGGTGGGGATGTGGAGAAATTGG - Intronic
1094290524 12:28843085-28843107 TTCTGAGGATGCAGAGAAATTGG - Intergenic
1094360672 12:29627468-29627490 TGGTTGGGATGTAGAGAAATAGG + Intronic
1096102279 12:48977205-48977227 GTATGGTGATGGAGAGGACTGGG - Intergenic
1096182146 12:49556953-49556975 TTGAGGGGAAGGAGAGCACTAGG + Intronic
1096638619 12:52976789-52976811 GAGGGGGGATGGAAAGAACTGGG + Intergenic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1100272202 12:93037230-93037252 TAGTGAGGATGTAGAGAAATTGG - Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100432649 12:94544363-94544385 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1101709997 12:107256413-107256435 TTGTGGGAATGGGGAAAACAGGG + Intergenic
1101741970 12:107507676-107507698 TTGTGGGGATTGTAAGAAGTTGG - Intronic
1101931059 12:109014674-109014696 TGGTGAGGATGTAGAGAAATTGG - Intronic
1102013201 12:109631562-109631584 TTGTGAGGATTGTGTGAACTGGG - Intergenic
1102422352 12:112814001-112814023 TGGTGGGTATGGAGTAAACTAGG + Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103255819 12:119540540-119540562 TTGAGGGGAGGGAGAGAAGGTGG + Intronic
1103393731 12:120592074-120592096 TGGTGGGGATAGAGAGAAACGGG + Intergenic
1103605050 12:122079762-122079784 TTGTGGGGATGGAGTGAGATAGG + Intronic
1103952407 12:124558286-124558308 TGGTGGGGCTGGGGAGACCTTGG - Intronic
1104078991 12:125413974-125413996 TGGTGAGGATGTAGAGAAATTGG - Intronic
1104896057 12:132164198-132164220 TGGCGGGGATGTGGAGAACTTGG - Intergenic
1104956271 12:132467442-132467464 TGTTGGGGATGTAGAGAAATTGG + Intergenic
1105334483 13:19453488-19453510 TTTTAGGCATTGAGAGAACTAGG - Intronic
1105685209 13:22774222-22774244 GTGTGGGTAAGGAGAGAGCTGGG + Intergenic
1105889946 13:24675543-24675565 TTGGGGGAATGGAGAGATGTAGG + Intergenic
1106731740 13:32548407-32548429 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1107056127 13:36105857-36105879 TTGGGATGATGGAAAGAACTTGG - Intronic
1107489223 13:40864702-40864724 TAGTGGGGAGGGATAGCACTGGG - Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108226713 13:48296798-48296820 TGGTGGTGGTGGGGAGAACTAGG + Intergenic
1108411439 13:50151655-50151677 TAGTGAGGATGGGGAGAAATTGG - Intronic
1108638223 13:52357256-52357278 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1108908200 13:55505948-55505970 TTGGGGGGAGGGAGAGCATTAGG + Intergenic
1108979293 13:56490362-56490384 TTGAGGAGAGGGAGAGAATTGGG - Intergenic
1109889617 13:68591633-68591655 TAGTAGGGATGCAGAGAAATAGG - Intergenic
1110227100 13:73131175-73131197 TTGAGGGGAAGGAGAGAATATGG + Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110889104 13:80675895-80675917 TTGTGGGGAGGGAAAGCATTAGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111247737 13:85562946-85562968 AGTTGGGGATGGAGAGAAATGGG + Intergenic
1111482091 13:88843012-88843034 TAATGGGGACAGAGAGAACTGGG - Intergenic
1111538581 13:89638987-89639009 TTGTGAGGCTGTAGAGAAATTGG - Intergenic
1111931651 13:94518949-94518971 TCTTGGGGCTGGAAAGAACTTGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112588888 13:100745721-100745743 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1112649534 13:101379224-101379246 TGGAGAGGATGTAGAGAACTAGG + Intronic
1112705673 13:102066866-102066888 TTGTGAGGATGGGGAGAAACTGG - Intronic
1112733097 13:102388751-102388773 TTGTGGGGAGGGGCAGTACTAGG - Intronic
1112983693 13:105419722-105419744 TTGTGGGGAGGGAGAGCATCAGG + Intergenic
1113042134 13:106115945-106115967 GTGTGGGGAGGGAGAGCATTAGG - Intergenic
1113449238 13:110394848-110394870 TTGTGGGAGTGGAGAAAATTAGG - Intronic
1114848401 14:26352179-26352201 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1115339870 14:32282050-32282072 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116015974 14:39407923-39407945 TTGTGAGGATGTAGAAAAATTGG - Intronic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118527053 14:66657214-66657236 TTGTAGGGCTGAAGAGAATTCGG - Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119704683 14:76776336-76776358 ATGTGAGGATTGAGAGGACTGGG + Intronic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1120898648 14:89556994-89557016 CTGTGGGGTGGGAAAGAACTTGG + Intronic
1121198775 14:92099143-92099165 TATTGGGGAAAGAGAGAACTTGG - Intronic
1121507792 14:94489876-94489898 TTCTGTGGATGGAGAGAGATTGG - Intronic
1121994400 14:98591042-98591064 TGGCGGGGATGGAGAGAAAGCGG - Intergenic
1122043082 14:99003708-99003730 TTCTGGAGATGGACAGAATTGGG - Intergenic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1122689432 14:103524755-103524777 TTGGGGGGAGGGAGAGACTTGGG + Intergenic
1123159765 14:106267070-106267092 TAGTGGGGAGGGAGAGCATTAGG + Intergenic
1123466738 15:20522334-20522356 TTGTGTCGATGGAAAGAGCTTGG + Intergenic
1123651375 15:22478707-22478729 TTGTGTCGATGGAAAGAGCTTGG - Intergenic
1123741785 15:23287550-23287572 TTGTGTCGATGGAAAGAGCTTGG - Intergenic
1123745211 15:23315008-23315030 TTGTGTCGATGGAAAGAGCTTGG + Intergenic
1124052392 15:26209780-26209802 CTGAGGGGATGGAGAGTTCTTGG - Intergenic
1124127462 15:26949519-26949541 TTGTGGGCATGGTGACTACTTGG + Intergenic
1124277484 15:28338328-28338350 TTGTGTCGATGGAAAGAGCTTGG + Intergenic
1124305216 15:28573278-28573300 TTGTGTCGATGGAAAGAGCTTGG - Intergenic
1124365037 15:29065096-29065118 TTGTGGGGAGTGAGAGCATTGGG + Intronic
1124385541 15:29205452-29205474 TGGTGAGGATGTAGAGAAGTTGG - Intronic
1124576857 15:30917047-30917069 ATGTGGGGGTGGACAGGACTGGG + Intronic
1125702571 15:41700388-41700410 TGGTGGGGAGGGAGAGCATTAGG - Intronic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126326469 15:47483124-47483146 TTGGGGGCATGGAGGGAATTTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126930890 15:53649803-53649825 TTGTGAGGATGTAGAGAAATTGG + Intronic
1126962047 15:54007619-54007641 TTGTGGGGAGGTAGAGCATTAGG + Intergenic
1127316557 15:57800350-57800372 TTGTGAGGATGGAGAAAATGGGG - Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1129314246 15:74731586-74731608 TTGGGTGGATGTGGAGAACTGGG + Intergenic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129798467 15:78395847-78395869 TCGTGGAGCTGGAAAGAACTTGG + Intergenic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131836050 15:96392286-96392308 CTGTGAGGATGGAGTGAACTTGG + Intergenic
1132237372 15:100232327-100232349 TTGAGGGGAAGGAGAGGAGTTGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132936325 16:2483121-2483143 TGGTGGGAATGCAGAGAGCTGGG + Intronic
1132980592 16:2736949-2736971 TGGTGGGGGTGGAGAGTGCTTGG + Intergenic
1133304328 16:4800297-4800319 ATGTGGGGAGGTAGAGAACCTGG - Intronic
1134187127 16:12093267-12093289 GTGTTGGGATGGAAAGAACATGG + Intronic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1135206849 16:20491973-20491995 TGGAGGGGAAGCAGAGAACTCGG + Intergenic
1135212036 16:20531659-20531681 TGGAGGGGAAGCAGAGAACTCGG - Intergenic
1136125330 16:28175327-28175349 TTTTGGGGAGGGAGAAAACATGG - Intronic
1136179003 16:28538238-28538260 TTGTGGGGATGGGAAGAGCAGGG + Intronic
1137364936 16:47852485-47852507 TTGGGGGGGTGGAGAGGACAGGG - Intergenic
1137420045 16:48325393-48325415 TAGTGGGGATGGGGAGAGATTGG - Intronic
1138202152 16:55097392-55097414 TTGAGGGGAGGGAGAGCATTAGG - Intergenic
1138311332 16:56026015-56026037 TTGTGTGGATGGAGAGGACTGGG - Intergenic
1138610711 16:58121748-58121770 TTGCGGGGAGGGAGAGAAATCGG - Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1138755116 16:59475187-59475209 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1140867304 16:79074493-79074515 GTGGGGGAATGGAGAGACCTGGG + Intronic
1140913338 16:79473244-79473266 TTGTGGGCATGCAGACATCTGGG - Intergenic
1141650947 16:85392880-85392902 CTGGGTGGATGGAGAGACCTCGG - Intergenic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143476799 17:7207888-7207910 TTGTGGGGCTGGAAACACCTTGG - Intronic
1145065915 17:19761275-19761297 TTGTGAGGATGTGGAGAAATTGG - Intergenic
1145276264 17:21433034-21433056 TTATTGGGATGGAAAGACCTAGG + Intergenic
1145314106 17:21718948-21718970 TTATTGGGATGGAAAGACCTAGG + Intergenic
1145393647 17:22477036-22477058 TGGTGGGGAGGGAGAGTATTAGG - Intergenic
1146374896 17:32287427-32287449 TTGTAGGCATGGAGAGAATGGGG + Intronic
1146499750 17:33354304-33354326 TAGTGGGGATGGAGAGCATGAGG - Intronic
1146815780 17:35941130-35941152 TGGTGAGGATGTAGAGAAATTGG - Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147501503 17:40968559-40968581 TGGAGAGGATGGAGAGAAATTGG - Intergenic
1148633274 17:49128483-49128505 TTCAGGGGAAGGAGAGACCTGGG + Intergenic
1148860694 17:50602927-50602949 TGGTGGGGGTGGAGACAGCTTGG + Intronic
1149306776 17:55355602-55355624 TTGTGAGGATGGAGAAAATGAGG - Intergenic
1149391322 17:56194130-56194152 TTGTGGGGATGTGGAGCAATAGG + Intronic
1149689055 17:58558465-58558487 TAGTGGGGCTAGAGAGAATTTGG - Intronic
1149885787 17:60338806-60338828 TTGAGGGGATTGAGAAAACAAGG - Intronic
1150070165 17:62143571-62143593 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1150194244 17:63278486-63278508 TGGTGAGGATGTAGAGAAATTGG + Intronic
1150215677 17:63467602-63467624 TGATGTGGATGGAGAGAACTGGG + Intergenic
1150317740 17:64183735-64183757 TAGTGAGGATGTAGAGAAATTGG - Intronic
1150582508 17:66487653-66487675 TGGTGGGGATGCAGAGAAAAGGG - Intronic
1150714907 17:67563867-67563889 ATGTGGGGAGAGAGAGAAATGGG + Intronic
1150827944 17:68493143-68493165 TTGTGGGGAGGGAGAGCATCAGG + Intergenic
1150855542 17:68748951-68748973 ATGTGGGGAGGGAGAGCATTAGG - Intergenic
1150856491 17:68758221-68758243 ATGTGGGGAGGGAGAGCATTAGG + Intergenic
1151212551 17:72555346-72555368 TCTTGGGTATGGTGAGAACTAGG - Intergenic
1151552422 17:74829823-74829845 GTGTGGGGCTGGAGAGAGTTGGG - Intronic
1151636865 17:75355403-75355425 TTGGGGAGGAGGAGAGAACTGGG - Intronic
1152056124 17:78028254-78028276 TTCTGGGGATGGGGAGAAGTGGG + Intronic
1152369073 17:79874111-79874133 TGGTGGGGATGCACAGAAATAGG - Intergenic
1153049642 18:889670-889692 TGGTGGGAATGGAGAGAGTTGGG + Intergenic
1153344865 18:4014408-4014430 TTGTGGGGGTGAAGAGATGTTGG + Intronic
1153370763 18:4313289-4313311 TTGGGTGGATAGAGAGACCTGGG + Intronic
1153474672 18:5486304-5486326 TTCTGTGGATGGTGAGAAATAGG - Intronic
1153679025 18:7483041-7483063 GTGTGGGGTTGGTGAGATCTGGG - Intergenic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155221128 18:23687101-23687123 TTGTGAGGATGTGGAGAAGTTGG - Intergenic
1155445371 18:25906257-25906279 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156189701 18:34704147-34704169 ATAATGGGATGGAGAGAACTGGG - Intronic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1157483556 18:48071498-48071520 TGGTGAGGATGTAGAGAAATTGG + Intronic
1157563777 18:48666084-48666106 TGGTGGGGATGTGGAGAAATTGG - Intronic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1158963683 18:62606160-62606182 TTGTGGGGGTGGGGAGAGCGGGG - Intergenic
1159917934 18:74202732-74202754 GTGAGAGGATGGAGAGGACTTGG - Intergenic
1159949282 18:74468652-74468674 TGGAGGAGATGGAGGGAACTGGG + Intergenic
1160520122 18:79503115-79503137 TTTTGGGGATGGATAACACTCGG - Intronic
1160744251 19:703456-703478 TTGTGGGGCTGCAGGGCACTGGG + Intergenic
1161238355 19:3208772-3208794 TTGCTGGGAAGGAGAGGACTTGG + Exonic
1161274323 19:3407067-3407089 ATGGGGAGATGGGGAGAACTTGG + Intronic
1161397463 19:4052267-4052289 TTGGTGGGGTGCAGAGAACTGGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162003678 19:7763902-7763924 TCCTGGGGAAGGTGAGAACTGGG + Intronic
1162018858 19:7859731-7859753 TTGGGGGGATGCAGAGATCGGGG + Intronic
1163775861 19:19217037-19217059 TTGTGGGGAGGGAGAGATTGGGG + Intronic
1164738264 19:30558395-30558417 TGGTGGGGGTGGAGGGTACTTGG + Intronic
1165345534 19:35246804-35246826 TGGTGGGGATGTGGAGAAATTGG + Intergenic
1166537089 19:43581110-43581132 TTGTGGGGTTGGGGAGGCCTAGG + Exonic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168429778 19:56269260-56269282 TTGAGGGGATGTGGAGAAATTGG - Intronic
925445539 2:3923862-3923884 TGGTGGGGGTGGAGGGATCTGGG + Intergenic
925993471 2:9272192-9272214 TTGTGGGGATGTGGAGAAAAGGG - Intronic
926092780 2:10061371-10061393 TTGTTGGGAAGAAGAGAAATGGG + Intronic
926426824 2:12745880-12745902 CTTTGGGGATGGTGACAACTGGG - Intergenic
926687790 2:15711333-15711355 ATGAGGGGATAGAGAGAAATCGG + Intronic
926918459 2:17915897-17915919 TTGTGGGGAGGGAGAGAGAAAGG + Intronic
927298927 2:21488012-21488034 TTGTGAGGAGGGAGAGCATTAGG - Intergenic
927801491 2:26104215-26104237 TAGTGAGGATGTAGAGAAATTGG - Intronic
928613164 2:33010379-33010401 TGGGGGGGATGAAGAGAAATTGG + Intronic
928935698 2:36675528-36675550 TGGTGAGGATGTAGAGAAATTGG + Intergenic
929030056 2:37641551-37641573 TTCTGGGGAGGGAGAGACCTGGG - Intergenic
929348080 2:40911646-40911668 TTGTGAGGATGCAGAGAAAGTGG - Intergenic
929647335 2:43640576-43640598 TGGTGAGGATGTAGAGAAATGGG - Intronic
929729122 2:44467825-44467847 TTTTGTGCATGGTGAGAACTAGG - Intronic
929734898 2:44537531-44537553 TGGTGAGGATGGAGAGAAAAGGG + Intronic
930256321 2:49096951-49096973 TTCTGGGGCTGGGGAGACCTTGG - Intronic
930540099 2:52694882-52694904 GGTTGGGGATGGAGAGAACAGGG + Intergenic
930588324 2:53296911-53296933 TCATGGGGATGGAGAGTACAAGG + Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932110961 2:68999772-68999794 TTGTGGGGAGGGAGAGCATCAGG - Intergenic
932521375 2:72417002-72417024 TTTTGGGGATGGACAGAAGGTGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932671514 2:73741391-73741413 TGGTGGGGATCCAGAGACCTTGG + Intergenic
933858754 2:86442905-86442927 ATGAGGGGAGGGAGAGAATTGGG + Intronic
934502199 2:94870228-94870250 TGGTGGGGCTGGAGAGACCCTGG + Intergenic
934698397 2:96417297-96417319 TGGTGAGGATGCAGAGAAGTAGG - Intergenic
934728216 2:96638587-96638609 CGGTGGGGGTGGCGAGAACTGGG - Intronic
935275978 2:101475466-101475488 TGGTGAGGATGTAGAGAAATTGG + Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937065701 2:119015518-119015540 GTGTGGGGAGGGAGAGCACTGGG - Intergenic
938866657 2:135428892-135428914 TGGTGGGGTTGAAGAGAAATGGG + Intronic
938898315 2:135775153-135775175 TTGTGAGGATGTGGAGAATTTGG + Intronic
939069640 2:137523749-137523771 AAGTGGGGATGGCAAGAACTAGG - Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940634871 2:156286798-156286820 TTGTGAGGATTAAAAGAACTTGG - Intergenic
941212016 2:162651836-162651858 TGGTGAGGATGCAGAGAACAGGG - Intronic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942404764 2:175642419-175642441 TAGTGGGGATGTTGACAACTGGG - Intergenic
942529902 2:176898391-176898413 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
943731543 2:191307955-191307977 TTGGGGAGATGGAGGGATCTAGG - Intronic
943848363 2:192681390-192681412 TTGTTGGGATGTGGAGAAATTGG - Intergenic
944117411 2:196204297-196204319 TGGTGAGGATGTAGAGAAATTGG - Intronic
944288041 2:197974149-197974171 TTATGAGGAGGGAGAGACCTGGG + Intronic
944368392 2:198951735-198951757 TTGTGAGGACGTAGAGAAATTGG - Intergenic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946388705 2:219402241-219402263 TGGTGGGGAAGGAGAGATCAGGG + Intergenic
947722950 2:232380397-232380419 CTGTGGGGAGGGAGAGAGCCAGG - Intronic
948464439 2:238145492-238145514 TTATGGGGATGGAGGGACCTGGG + Intronic
948745007 2:240084088-240084110 TTGTGGAAATGCAGAGAACATGG + Intergenic
1169170760 20:3463058-3463080 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1169322793 20:4648134-4648156 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1170287368 20:14724998-14725020 TTCTGGAGATGGAGACAAATGGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1172640569 20:36437912-36437934 TTGTGGGGATGTGGGGAACAGGG + Intronic
1172905773 20:38368210-38368232 ATGAGGGGATGGAGAAACCTTGG + Intronic
1173006585 20:39144142-39144164 TTGTGGGGAGGGATAGCATTGGG + Intergenic
1174273005 20:49383237-49383259 TTGTGGGGATGGAAAGCAATGGG - Intronic
1174839543 20:53888577-53888599 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1176242259 20:64080464-64080486 CTGCGGGGCTGGGGAGAACTGGG + Intronic
1177198956 21:17932313-17932335 TTGTGAGGATGAAGAGAAAAGGG + Intronic
1178095512 21:29211104-29211126 TGGTGAGGATGTAGAGAAATTGG + Intronic
1178289353 21:31353728-31353750 TAGTGAGGTTGGAGAGAGCTGGG - Intronic
1179366571 21:40764458-40764480 TGGTGAGGATGCAGAGAAATAGG + Intronic
1180015312 21:45078507-45078529 TGGTGAGGATGGAGTGAGCTGGG + Intronic
1180855765 22:19043787-19043809 GTGTGGGCATGGAGTGTACTGGG - Intronic
1181019859 22:20094036-20094058 TTGTGGGGGTGGAGATGCCTTGG + Intronic
1181592309 22:23893049-23893071 TTCAGGGAATGGAGAGAAGTGGG + Intronic
1182378265 22:29864770-29864792 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1182392818 22:30013415-30013437 GTGTGGTCATGGGGAGAACTCGG + Exonic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183366926 22:37411784-37411806 TGGAGGGGATGGAGTGAAATAGG - Intronic
1184011284 22:41750554-41750576 GTGTGGGGAAGGTGAGAAATGGG + Intronic
1185122097 22:48977429-48977451 TTCTGGTGCTGGAGAGACCTCGG + Intergenic
1185160619 22:49226979-49227001 TGGTGAGGATGTAGAGAAATGGG + Intergenic
1185190282 22:49432141-49432163 TTTTGGGGATGCAGATAAATCGG - Intronic
949380557 3:3440793-3440815 TAGTGAGGATGTAGAGAAATTGG + Intergenic
950097550 3:10338762-10338784 CTCTGGGCATGGTGAGAACTGGG + Intronic
951919153 3:27834552-27834574 GTGTGGGGAGGGAGAGAATCAGG - Intergenic
952549006 3:34454741-34454763 TGGTGAGGATGCAGAGAAATAGG - Intergenic
952712136 3:36442470-36442492 CTGTGGGGATGGACAGAGCAAGG + Intronic
953041818 3:39262245-39262267 TTGGGTGGTTGGAGATAACTGGG - Intergenic
953122792 3:40061717-40061739 TTGTGAGGTTGCAGAGAAATGGG - Intronic
953472656 3:43180161-43180183 TTGTGGGGAGGGAGAGGAAGAGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
954506050 3:51074684-51074706 GTGAGGGGAGGGAGAGAATTAGG + Intronic
954667151 3:52261780-52261802 TGGTGAGGATGCAGAGAAATTGG + Intronic
954892426 3:53943416-53943438 CTGACGGGATGGAGAGAGCTTGG + Intergenic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
955208275 3:56917193-56917215 TTGTGGGGAAGGAGTGAGCCAGG - Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
956042532 3:65159625-65159647 TTGTGAGGATGTGGAGAAATTGG - Intergenic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956373825 3:68592664-68592686 GTGGGGGGAGGGAGAGAATTAGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956839336 3:73122644-73122666 TGGTGAGGATGCAGAGAAATTGG + Intergenic
958645458 3:96865960-96865982 TTGTAGGGGTGGAGACTACTTGG - Intronic
959068961 3:101685137-101685159 TGGTGAGGATGGGGAGAAATTGG - Intronic
959304851 3:104649291-104649313 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
959864004 3:111245252-111245274 TTGTTAGGATGGAAAAAACTGGG + Intronic
960173335 3:114488594-114488616 TAGTGAGGATGCAGAGAAATGGG + Intronic
960329139 3:116336648-116336670 TGGTGAGGATGGGGAGAAATTGG + Intronic
960431607 3:117575968-117575990 TGGAGGGGATGAAGAGAAGTTGG - Intergenic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
960967804 3:123117013-123117035 TTGTGGGGGAGAAGAGAGCTGGG + Intronic
961221516 3:125204584-125204606 TTGGGGGGATGAAGAGAGGTTGG + Intronic
961667880 3:128504862-128504884 TTGACCGGAGGGAGAGAACTGGG - Intergenic
961937435 3:130600223-130600245 TTGTGAGGATGTGGAGAAATAGG + Intronic
962147017 3:132850218-132850240 TGGTGGGGATGCAGTGAAATGGG - Intergenic
962255970 3:133870486-133870508 TGGTGGGGCTGGAGAGAATGGGG + Intronic
962269618 3:133968153-133968175 ATGTGGGGATGGGAAGGACTTGG - Intronic
962275113 3:134006956-134006978 TTTTGAGGATGGAGAGAAATTGG - Intronic
962419407 3:135214954-135214976 TTTTATGGATGAAGAGAACTAGG - Intronic
962611163 3:137077465-137077487 TGGAGGGAATGGAGAGAAATGGG - Intergenic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962932886 3:140053817-140053839 TTGTGGAGATGGAGTGAGATGGG + Intronic
963015344 3:140819258-140819280 TTGTGGGGAGGGAGAGCATTAGG - Intergenic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963113370 3:141705140-141705162 TTGTGTGGATGCAGTGAACAGGG + Intergenic
965053915 3:163689552-163689574 ATGTGGGGATTGAGAGAAAGTGG - Intergenic
965181478 3:165408853-165408875 TTGTGGGGAGGGATAGCATTAGG + Intergenic
965373768 3:167896301-167896323 TTGTTGTGATGGAGAGAGGTGGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965908249 3:173737889-173737911 TGGTGAGGATGCAGAGAAGTTGG - Intronic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
966882350 3:184357585-184357607 TTGTGGGGCTGGACTGACCTAGG + Intronic
967576158 3:191096230-191096252 TTGTGGGCATAGAGAGATCTTGG + Intergenic
967650302 3:191977559-191977581 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
971441190 4:26687952-26687974 TTGTGGGAATGGCAAGAATTTGG + Intronic
971464746 4:26944906-26944928 TTGTGGGAATAGAGAGTATTTGG + Intronic
971530917 4:27687638-27687660 TGGTGAGGATGCAGAGAAATGGG - Intergenic
972083581 4:35184314-35184336 TGGTGAGGATGGGGAGAAATAGG + Intergenic
972790548 4:42367620-42367642 CTGTGGGGATAGTGAGAGCTTGG + Intergenic
972886217 4:43492207-43492229 TTCTGGGGAAGGAGAGATCCAGG + Intergenic
973050181 4:45586275-45586297 TTGTGGAGAAGGAAAGTACTGGG + Intergenic
973629583 4:52807508-52807530 TGGTGAGGATGCAGAGAAATAGG + Intergenic
973788706 4:54358747-54358769 TGGTGGGAATGGAGAGTCCTAGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974668663 4:64999797-64999819 TTGTGGGGAAGGAGAGCATCAGG + Intergenic
975762548 4:77633425-77633447 TGGTGGGGATGGTGATAACCAGG - Intergenic
975889716 4:79012715-79012737 TTGTGGGGAGGGAGAGCATCAGG + Intergenic
976031806 4:80764452-80764474 TGGCGAGGATGGAGAGAAATAGG + Intronic
976203019 4:82598507-82598529 TCCTGGGGATGGGGAGAACCTGG + Intergenic
976415083 4:84763391-84763413 TTAAGGGGAGGGAGAGAATTAGG + Intronic
976520720 4:86022232-86022254 TGGTGAGGATGTAGAGAAATTGG - Intronic
977238213 4:94534590-94534612 TTGTGGAGATGCAGAAACCTGGG + Intronic
977726004 4:100297830-100297852 TTTTGGGAGTGGAGAGAATTAGG + Intergenic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
979176216 4:117667279-117667301 TTGTGAGGATGTGGAGAAATAGG - Intergenic
979318539 4:119296851-119296873 TGGTGAAGATGGAGAGATCTTGG - Intergenic
979742910 4:124173652-124173674 TTGTGGGGAGGGAGAGCATCAGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981723330 4:147823380-147823402 GTGTGGAAAGGGAGAGAACTTGG + Intronic
983044689 4:162972042-162972064 TTTTGGAGATGGAGAGATATGGG - Intergenic
983308880 4:166030124-166030146 TGGTGAGGATGGACAGAAATTGG - Intronic
983604270 4:169568225-169568247 TTGTGGGGGTAGAGAGAGATGGG - Intronic
983625796 4:169800853-169800875 TTGAGGGGAAGGAGAGGAGTAGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984184456 4:176526307-176526329 ATGTGGGGAGGGAGAAAACAGGG + Intergenic
984376696 4:178939626-178939648 TTATGGAGATGAAGAGAATTGGG + Intergenic
984854870 4:184186567-184186589 TTGAGAGGAAGGAGAAAACTTGG + Intronic
985139972 4:186829833-186829855 CTGTAGGGATTGAGAGGACTTGG - Intergenic
985290929 4:188386698-188386720 TTGTGGAGTAGGAGAGCACTGGG + Intergenic
985687992 5:1292204-1292226 TTGTGGGGAGGGGGTGAAATCGG + Intronic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
986414278 5:7512456-7512478 TTGTAGGGATGGAAAGAATGAGG + Intronic
987290479 5:16504038-16504060 TTGGGGGGAGGGAGAGCATTAGG - Intronic
988044792 5:25937008-25937030 TGGTGAGGATGGGGAGAAATAGG - Intergenic
988748475 5:34169786-34169808 TGGTGAGGATGTAGGGAACTTGG + Intergenic
988999918 5:36749330-36749352 TTGGGGGAAAGGAGAGAAATGGG - Intergenic
989368419 5:40680701-40680723 TTGTGGGGAGGAAGAGGAATGGG + Intronic
989397274 5:40971218-40971240 TGGTGGGGATGTGGAGAAATAGG - Intronic
989753991 5:44929430-44929452 TGGTGAGGATGGGGAGAAATGGG - Intergenic
990130490 5:52576295-52576317 TTGTGTGGATGAAGAGAAAGTGG - Intergenic
990320330 5:54623618-54623640 GTGTGGGAATGGAGAAGACTTGG - Intergenic
990480233 5:56203477-56203499 TTGTGGGGAGGGATAGCATTAGG - Intronic
990532121 5:56684516-56684538 ATGAGGGGATGGAGAGAATGTGG - Intergenic
990614939 5:57498247-57498269 ATGGGTGGATGGAGAGAAATAGG - Intergenic
991661201 5:68952390-68952412 CTGTGGGGATTGAGAGAGCCTGG - Intergenic
992404680 5:76445838-76445860 TTGTTGGGGAGGAGAGAACGGGG - Intronic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
993017697 5:82554268-82554290 TTGTGAGGCTGTAGAGAAATTGG - Intergenic
993258729 5:85629035-85629057 TGGTGGGGAAGTAGAGAAATTGG - Intergenic
993785672 5:92132293-92132315 TTGAGAGGAGGGAGAGGACTGGG - Intergenic
994136806 5:96297452-96297474 TGCTGGTGAGGGAGAGAACTGGG + Intergenic
994267169 5:97731587-97731609 TTTTGGAGAGGGAGAGCACTTGG - Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
995900722 5:117063047-117063069 TGGTGGGGAGGGAGAGTATTAGG + Intergenic
996224198 5:120970233-120970255 TGGAGAGGATGGAGAGAAATAGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996617220 5:125456527-125456549 TTGTGAGGATGTGGAGAAATAGG - Intergenic
996926382 5:128831681-128831703 TTGTGTTGATTGAGAGGACTGGG + Intronic
997797286 5:136823150-136823172 TAGTGGGGAGGGATAGCACTAGG - Intergenic
998405159 5:141870115-141870137 TTATGGGGGTGGAGAATACTGGG - Intronic
998924727 5:147109689-147109711 TTGTTGCCATGGAGGGAACTGGG + Intergenic
998985587 5:147752710-147752732 ATGGGGAGATGGAGAGATCTAGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999335901 5:150716219-150716241 TTAAGGGGATGGGGAGAAATGGG + Intronic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000819404 5:165965043-165965065 TGGTGAGGATGCAGAGAAATAGG - Intergenic
1001105815 5:168853696-168853718 TCGTGAGCATGGACAGAACTGGG - Intronic
1001165269 5:169359788-169359810 TTGTGAGGATGCAGAGAAAAGGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002209235 5:177586344-177586366 TGGTGTGGATGGAGTGAACAGGG - Intergenic
1002292362 5:178208736-178208758 TTGAGGGGATGCAGACATCTGGG + Exonic
1002484292 5:179523975-179523997 TGGTGGCGAGGGAGGGAACTGGG - Intergenic
1002500282 5:179643513-179643535 TGGTGGCGAGGGAGGGAACTGGG + Intronic
1002647827 5:180669909-180669931 TTGTGGGGATGGAATGAGGTTGG - Intergenic
1002975841 6:2075401-2075423 TTGTGGGGAGGGATAGCATTAGG - Intronic
1003151714 6:3557975-3557997 TTCTGGGGATGGGGAGGAGTGGG + Intergenic
1003450163 6:6223362-6223384 TTGTAGGCATGGGGAGAACTTGG + Intronic
1003824513 6:9938312-9938334 CTGCGGGAATGCAGAGAACTGGG - Intronic
1004469216 6:15914030-15914052 TTGTGAGGATGTGGAGAAATTGG + Intergenic
1004586721 6:17009460-17009482 TTGGGGGGATGAAGAGAGTTTGG + Intergenic
1004883364 6:20030258-20030280 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1004911244 6:20287181-20287203 TGGTGGGGATGGATAGAAACTGG + Intergenic
1005472492 6:26175513-26175535 GTGTGTAGATGTAGAGAACTTGG + Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1008497259 6:52145714-52145736 TTGGGGGGGTGGAAGGAACTTGG + Intergenic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1008795392 6:55296526-55296548 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1009600914 6:65797973-65797995 GTGTGGGGATGGAGCAAAATTGG + Intergenic
1009823124 6:68830367-68830389 TTGTTGGAATTGAGAGATCTTGG - Intronic
1010001103 6:70950065-70950087 TTGGGGGGAGGGAGAGCATTAGG + Intronic
1012198389 6:96374246-96374268 TGGTGAGGATGGAGAGAATCTGG + Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1012680042 6:102168821-102168843 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1013060869 6:106632590-106632612 TGGTGAGGATGGAGAAAAGTTGG - Intronic
1013708806 6:112873111-112873133 TAGTGAGGATGTAGAGAAATAGG + Intergenic
1013715800 6:112960012-112960034 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014344632 6:120252700-120252722 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1014443689 6:121502074-121502096 TTGTGGGAGGGTAGAGAACTGGG + Intergenic
1014465951 6:121757122-121757144 TTCTAGGGATGGAGTGAACAGGG + Intergenic
1015817975 6:137230081-137230103 AGGTGGGGCTGGGGAGAACTGGG + Intergenic
1015915574 6:138212873-138212895 TTGTGGGGAGGGATAGCATTAGG + Intronic
1017553929 6:155542624-155542646 TTGTGGGGATGAAGAGGAATTGG + Intergenic
1017944870 6:159087772-159087794 GGGTGAGGATGAAGAGAACTGGG + Intergenic
1018211235 6:161484029-161484051 TTGTGGGGAGGGAGAGCATCAGG + Intronic
1018332310 6:162743006-162743028 TTGTGGGGATGTGGAAAAATGGG - Intronic
1018412111 6:163560487-163560509 TTGTGGGGATGGGGATAGGTAGG + Intronic
1019705406 7:2495018-2495040 TGGAGGGGATGGCGAGAACAAGG - Intergenic
1020144739 7:5633772-5633794 TTGTGGGGATGGCAAGCACCCGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1020891402 7:13882393-13882415 TTGTGGGGAGAGAGTGAACACGG + Intergenic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021690378 7:23224954-23224976 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1021792554 7:24220038-24220060 GTGTGGGGAGGGAGAGCATTAGG + Intergenic
1021924074 7:25518063-25518085 TTGTGGGGAGGGAGAGGGCTTGG + Intergenic
1022351797 7:29573111-29573133 TTGAGGGGTTGGAGAGAAAAGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023101071 7:36719262-36719284 TTGTGTGGCTGAAGAGCACTTGG + Intronic
1023272741 7:38482884-38482906 TTGTGGGGAAGGAGAGTCCAGGG - Intronic
1023372421 7:39525044-39525066 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1024132614 7:46370572-46370594 TGGCGAGGATGGAGAGAAATTGG - Intergenic
1024616714 7:51121152-51121174 TGGCGGGGATGTAGAGAAATTGG - Intronic
1024855795 7:53777496-53777518 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1026019776 7:66697954-66697976 TAGTGGGGATGGAGAGGGCCGGG - Intronic
1026187429 7:68092812-68092834 TTGAGGGGAGGGAGAGCATTAGG - Intergenic
1030704561 7:112678091-112678113 AGATGGAGATGGAGAGAACTGGG + Intergenic
1031392859 7:121237543-121237565 TGCTGGGGAAGGAGAGAAATAGG - Intronic
1031462945 7:122074112-122074134 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1031651376 7:124294638-124294660 TGGTGAGGATGGGGAGAAATTGG + Intergenic
1031679676 7:124655962-124655984 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032323908 7:130908849-130908871 TTGGGGGGATGGGGAGATGTGGG + Intergenic
1032514405 7:132496024-132496046 GTGTGGGGATGGACAGACCTGGG + Intronic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1034015460 7:147580106-147580128 ATGTGGGAATGAAGAGTACTTGG - Intronic
1034131084 7:148718377-148718399 TTGTGGGGATGGTGGGAATGGGG - Intronic
1034313672 7:150111117-150111139 GTCTGGGGATGGAGAACACTGGG - Intergenic
1034740391 7:153468081-153468103 TTGAGGGGATGGAGAAAAGGTGG - Intergenic
1034793230 7:153989679-153989701 GTCTGGGGATGGAGAACACTGGG + Intronic
1034998233 7:155591779-155591801 GTGTGGCTATGGAGAGAGCTTGG - Intergenic
1036802308 8:11802003-11802025 TTCTAGGGCTGGAGAGATCTAGG + Exonic
1037602441 8:20408739-20408761 TTGTGGGGATGGTCAGACCATGG + Intergenic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1039076481 8:33694475-33694497 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1039929051 8:41966564-41966586 TTAGGTAGATGGAGAGAACTAGG - Intronic
1040756911 8:50787353-50787375 TAGTGAGGATGTAGAGAAATTGG + Intronic
1040885396 8:52257416-52257438 TGGTGAGGATAGAGAGAAATTGG - Intronic
1040989326 8:53332674-53332696 TGGTGAGGATGCAGAGAAGTTGG - Intergenic
1041365277 8:57096306-57096328 TGGTGAGGATGTGGAGAACTTGG - Intergenic
1041530166 8:58856784-58856806 TGGAGGTGATGGAGAGAGCTAGG + Intronic
1041754357 8:61297379-61297401 TCATGGGGATGGAAATAACTGGG + Intronic
1042005309 8:64173071-64173093 TTGTGGGGAGGGAGAGCATCAGG - Intergenic
1043135681 8:76521013-76521035 TGGTGAGGATGCAGAGAAATGGG - Intergenic
1043217903 8:77619103-77619125 ACCTGGGGAGGGAGAGAACTTGG - Intergenic
1043235001 8:77853461-77853483 TTGCGAGGATGCAGAGAAATGGG - Intergenic
1043372558 8:79611709-79611731 GGGAGGGGATGGAGAGAACTGGG + Intronic
1044519113 8:93177259-93177281 GGGTGAGGATGAAGAGAACTGGG + Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1044638610 8:94354575-94354597 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1044847808 8:96399101-96399123 TTCTGGGGAAGGAGGAAACTGGG - Intergenic
1045070344 8:98497801-98497823 TTGCGAGGATGTAGAGAAATTGG + Intronic
1045286591 8:100796931-100796953 CTTTGGGGCTGGAGAGACCTCGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045342840 8:101269678-101269700 GCGTGGGGAAGGAGAGCACTGGG - Intergenic
1045511623 8:102816142-102816164 GAGAGGGGAAGGAGAGAACTGGG + Intergenic
1046874602 8:119239767-119239789 TTGTGGGGAGGGATAGCATTAGG + Intronic
1047755400 8:127914320-127914342 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1048048344 8:130794061-130794083 ATGTGAGGATGGAAAGAAATTGG + Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048521732 8:135161783-135161805 TTCTGGTTATGCAGAGAACTTGG - Intergenic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1052050876 9:23848914-23848936 CTGTTGCCATGGAGAGAACTGGG - Intergenic
1052392997 9:27903044-27903066 TTGCGGGGAAGGAGAGAAGCAGG - Intergenic
1052810801 9:33057763-33057785 TTGTGAGTTTGTAGAGAACTGGG - Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054375190 9:64444252-64444274 TTGTGGGGGTGGGGAGAGTTGGG + Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1055176249 9:73321143-73321165 GTGTTGGAATGGAAAGAACTAGG - Intergenic
1056680486 9:88713576-88713598 TAGTGGGGATGGTGATAACAGGG - Intergenic
1056855738 9:90128189-90128211 TTGTGTGGAGGATGAGAACTAGG - Intergenic
1057301040 9:93882551-93882573 TTCTGGGGATGGAGTGACCATGG - Intergenic
1057492584 9:95533059-95533081 TGGTGGGGATGTGGAGAAATGGG + Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058705266 9:107632559-107632581 ATGTGTGGATGGCAAGAACTGGG + Intergenic
1059541778 9:115137432-115137454 TTGCAGGGATGGAGGGAATTGGG + Intergenic
1059713229 9:116888837-116888859 TTGTGGGGAGGGAGAGCATCAGG - Intronic
1059820652 9:117968659-117968681 TGGGGGAGATGGAGAGAACAAGG + Intergenic
1060258656 9:122054727-122054749 CTGTGAGGAAGTAGAGAACTGGG - Intronic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060689977 9:125649169-125649191 TTGTAGGTATGGAGGGGACTAGG - Intronic
1062586189 9:137251050-137251072 TTGCGGGGAGGGAGAGGGCTGGG + Intergenic
1062730146 9:138104090-138104112 TTCTGGGCATGGAGAGACCAAGG + Intronic
1203563106 Un_KI270744v1:74114-74136 TGGTGGTGCTGGAGAGACCTGGG + Intergenic
1185852204 X:3499619-3499641 TTATGGGGGTGGATAAAACTTGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186301336 X:8202935-8202957 TAGTGGGGATGGAGAGTATATGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1187119467 X:16390217-16390239 TTGTGAGGATGCAGAGAAATTGG + Intergenic
1187593979 X:20750511-20750533 TGGTGAGGATGTAGAGAAATGGG - Intergenic
1187596468 X:20778029-20778051 TGGTGGGGATGCAGAGAAAGAGG + Intergenic
1187924875 X:24240558-24240580 TTATGGGGATACAGAGAAATTGG + Intergenic
1188202955 X:27315742-27315764 TTGTGAGGATGTGGAGAAATTGG + Intergenic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1188758027 X:33987955-33987977 TGGTGGGGATGTAGATGACTAGG + Intergenic
1189370509 X:40424560-40424582 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1189410305 X:40764498-40764520 TTGTGGGGAGGGAGAGCATTAGG + Intergenic
1189475904 X:41355423-41355445 TGGTGAGGATGCAGAGAAATTGG - Intronic
1189651777 X:43197621-43197643 TTATGGGGAGGGAGAGCATTAGG - Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190448220 X:50552431-50552453 TGGTGGGGCTGGAGAGAAACAGG + Intergenic
1190821240 X:53974913-53974935 TGGTGGGGAAGGAGAGTACAAGG + Intronic
1191042256 X:56095806-56095828 TGGTGGGGATGCAGAGAAAAAGG + Intergenic
1191218694 X:57961843-57961865 TTGTGAGGATGGGGAGAAATTGG - Intergenic
1191219506 X:57972724-57972746 TTGTTGATATGGAGAGAAATGGG + Intergenic
1191653906 X:63575299-63575321 TTGAGGGGAAGGAGAGCATTAGG + Intergenic
1191865227 X:65698481-65698503 TTGTGGGGAGGGAAACAACTGGG - Intronic
1191878465 X:65820790-65820812 ATGTGGGGAGGGAGAAAAATTGG + Intergenic
1192405894 X:70885948-70885970 TGGTGAGGATGTAGAGAAATTGG + Intronic
1192441830 X:71180212-71180234 TTGAGGGGATGGCTTGAACTGGG + Intergenic
1192536318 X:71931032-71931054 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193671466 X:84391583-84391605 TAGTGAGGATGCAGAGAAATAGG - Intronic
1193859787 X:86651213-86651235 TTGTGGGGCAGGAGAGAGGTGGG + Intronic
1194563397 X:95450284-95450306 GTGAGGGGAGGGAGAGCACTAGG + Intergenic
1194903818 X:99548285-99548307 TTGTGAGGATGGAAACAAATTGG + Intergenic
1195003091 X:100661126-100661148 TTGTGAAGATGGAGAGAAACTGG - Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195585049 X:106555504-106555526 TTGTGGGGATGTGGAGAAAAAGG + Intergenic
1195635606 X:107111866-107111888 TGGTGGGGATGGAGAAAACGGGG + Intronic
1195808080 X:108798051-108798073 TAGTGGGGATTGAGGGAGCTTGG - Intergenic
1195931915 X:110086882-110086904 TAATGGGGATGGTGAGATCTTGG + Intronic
1195935491 X:110121820-110121842 TAGTGAGGATGTTGAGAACTTGG - Intronic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1197186988 X:123598644-123598666 TTTTGGGGATGGTGAGAAGGTGG - Intergenic
1197373097 X:125648206-125648228 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
1197849646 X:130844044-130844066 TTGTGGGGATTAACAGTACTGGG - Intronic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198427698 X:136536241-136536263 ATGTGGGGAGGGAGGGAGCTGGG + Intronic
1198895900 X:141454261-141454283 TGGTGGGGATGTAGAGAAAAGGG + Intergenic
1198932018 X:141872011-141872033 TTTAGGGGAAGGAGAGACCTGGG + Intronic
1199016246 X:142819571-142819593 TGATGGGGATGGGGAGACCTGGG - Intergenic
1199167242 X:144691299-144691321 TGGCGGGGATGCAGAGAAATAGG - Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1199932837 X:152541994-152542016 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1200036688 X:153335473-153335495 TTGTGGGGATGTACTGAACTGGG - Intronic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1200885973 Y:8270079-8270101 TTGTGGGGAAGGATAGCATTAGG + Intergenic
1201685650 Y:16699016-16699038 CGGTGGGGAGGGAGAGCACTAGG + Intergenic