ID: 1107897547

View in Genome Browser
Species Human (GRCh38)
Location 13:44980927-44980949
Sequence CAAGCTTCTCCCACACGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107897547 Original CRISPR CAAGCTTCTCCCACACGAAA GGG (reversed) Intronic
900580749 1:3407468-3407490 CTGGCTTCTCCCAGAGGAAAGGG - Intronic
904243366 1:29166586-29166608 AAAGCTGCTACCACATGAAATGG + Intronic
915497494 1:156292249-156292271 CATGCCTCTCCCACAGGAAGAGG + Exonic
916002325 1:160628907-160628929 GGAGCTTCTGCCACAGGAAATGG - Intronic
923017893 1:230140739-230140761 CAAGCTTTTCCCTGAGGAAAAGG - Intronic
924902484 1:248416450-248416472 CAAATTTCCCCCACAGGAAATGG + Intergenic
1065221550 10:23501148-23501170 CAGGCTTCTCCCACAGAGAAGGG - Intergenic
1068604750 10:58992194-58992216 GAAGCTTCTCCCACACTAGAAGG + Intergenic
1068690825 10:59912089-59912111 AAAGCTACACCCACACCAAAAGG + Intergenic
1069379558 10:67829036-67829058 CAAACTTCACCCTCACAAAATGG + Intronic
1069551199 10:69365737-69365759 CAAGCTTCTCCCACATCACTGGG - Intronic
1070100215 10:73378732-73378754 CAAGCTTCTCCCACAGCATGAGG + Intronic
1070333959 10:75438268-75438290 CATGTTTCTCACACACAAAAAGG - Intronic
1072619237 10:97068651-97068673 GAAGCTTCCCCCACAAGAAGGGG - Intronic
1074675741 10:115848576-115848598 CATGCTTTTCCTACAGGAAAAGG - Intronic
1075535944 10:123272315-123272337 CCAACTTCTTCCAGACGAAATGG - Intergenic
1077766972 11:5169239-5169261 CAAGCTTCTGACAAACAAAAAGG - Intronic
1078823226 11:14904191-14904213 CAAGCTCCTCCAAGAAGAAATGG + Intergenic
1088878784 11:113957568-113957590 AAAGCTTCTCCCTCAGGAAGAGG - Intergenic
1090176740 11:124656756-124656778 CCAGCTTCTCCCAAAACAAAGGG + Intronic
1091293982 11:134459651-134459673 CACCCTTCTCCCACACAAAGCGG + Intergenic
1098587823 12:72175489-72175511 CCAGCTTGTTCCACATGAAAGGG - Intronic
1099800419 12:87450629-87450651 CAAGTTTCTCCCACAACACATGG - Intergenic
1101269117 12:103124335-103124357 CAAGGTTCTCCCTGAAGAAATGG + Intergenic
1103361763 12:120358828-120358850 CAAGTTTCTAGCACAGGAAATGG + Intronic
1107897547 13:44980927-44980949 CAAGCTTCTCCCACACGAAAGGG - Intronic
1109462993 13:62687942-62687964 CAAGCTCCTCCCACTGCAAAGGG + Intergenic
1110208553 13:72946662-72946684 CCAGTTTCTCCCACTTGAAATGG - Intronic
1112824285 13:103374130-103374152 AAAGCTTCTTTCACACTAAAAGG + Intergenic
1114876381 14:26725134-26725156 CAAGTTTCTTCCACCAGAAAAGG + Intergenic
1119094579 14:71817069-71817091 CAAATTTCTCCCACAAGAGATGG - Intergenic
1125399281 15:39283011-39283033 CAAGGTCTTCCCACACGAAATGG - Intergenic
1125600332 15:40912184-40912206 AAAGCTTGGCCCACAGGAAAGGG - Intergenic
1132558417 16:582749-582771 CTGGCTTCTCCCACAGGCAAGGG + Intronic
1132731531 16:1364834-1364856 CGAGCATCTCCCACACGAGCAGG + Intronic
1133689624 16:8200766-8200788 GAAGGTTCTCCCCCAAGAAAAGG + Intergenic
1139240457 16:65386418-65386440 CTATCTTCTCTCACACAAAAGGG + Intergenic
1145777996 17:27542954-27542976 CAAGCTTCTCGCAGAGGAGATGG + Intronic
1155504129 18:26516366-26516388 CAAACTTCTCTCATACAAAAGGG - Intronic
1156082637 18:33356841-33356863 CAAACTTCTGCCACAAGAGACGG - Intronic
1156831853 18:41501228-41501250 CCAGCTTTTCCTCCACGAAATGG - Intergenic
1157027465 18:43862812-43862834 CAACCTTCTCCCTCATGGAAGGG + Intergenic
1159325875 18:66916605-66916627 CAAACTTCTACCACAGGTAATGG - Intergenic
1162203170 19:9035926-9035948 CAGGGTTCTCCCACAGGAGATGG + Intergenic
1164903182 19:31945738-31945760 CCAGCTTCTCCCACTGGAAAAGG + Intergenic
1168268465 19:55236593-55236615 CAAGCTTCCACCACACGGCAGGG - Intronic
935634029 2:105236302-105236324 CAAGCTGTTCCCACAGCAAAGGG + Intergenic
937911889 2:127079856-127079878 CAGGCTCCTCCCAGACAAAATGG + Intronic
938973251 2:136451340-136451362 CAAATTTCTCCCACAAGAGATGG + Intergenic
947172062 2:227321855-227321877 AAAGCTTCTACAACATGAAAGGG - Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1173905867 20:46628315-46628337 CAAGATTCTCCCTCCCAAAATGG - Intronic
1174068305 20:47881796-47881818 CAAGCTCCACCCACACTCAAGGG - Intergenic
1181915559 22:26277031-26277053 CTGGCTTCTCCCCCACGAATGGG - Intronic
949770228 3:7570105-7570127 CAAGTTTCTCCCACAACACATGG + Intronic
950086215 3:10259794-10259816 CAAGCTCTTCCCACTGGAAAGGG - Intronic
956338593 3:68194052-68194074 CATGCTTTTCCCACAGCAAAGGG + Intronic
956790352 3:72675369-72675391 CAACCTCCTCCCACACTGAATGG + Intergenic
959598639 3:108154315-108154337 GAAATTTCTCCCACATGAAAAGG - Intergenic
974676499 4:65096481-65096503 CAAACTTCACCCACACACAATGG + Intergenic
976273307 4:83251389-83251411 CAAGCTACTTCCACAGGAGAGGG + Intergenic
977495431 4:97769413-97769435 CCAGCTTTTCCCAGACAAAAGGG + Intronic
982794814 4:159631702-159631724 CAAACTTCTGCCACAAGCAAAGG - Intergenic
987134174 5:14885439-14885461 CAAGCTTCACACATAGGAAAGGG + Intergenic
997811777 5:136977684-136977706 CATGCGACTCCCACACGACACGG - Exonic
997926623 5:138036090-138036112 CAACCTTGTCCCACAATAAAGGG - Intronic
999928427 5:156404887-156404909 CAAGTTTCTCCCTCACTGAAAGG - Intronic
1003142308 6:3481686-3481708 CCCGCTTCTCCCACACAAAGTGG + Intergenic
1003560881 6:7178913-7178935 AAAGCTTATCCCACTTGAAAAGG - Intronic
1005885847 6:30097127-30097149 CCAGCTTCTCCCACACAACATGG - Intergenic
1006732666 6:36247757-36247779 AGAGCTTCTCCCAGACCAAAAGG - Intronic
1007941778 6:45788234-45788256 AGAGCTTCTCCCACACAACAAGG + Intergenic
1009531603 6:64824283-64824305 AATGTTTCTCCCACAGGAAAGGG + Intronic
1026301971 7:69105946-69105968 CAAATTTCTCCCACAAGAGACGG - Intergenic
1031769690 7:125828520-125828542 CAAGCTTCTCCCATTTGGAATGG + Intergenic
1039106605 8:33996522-33996544 CAAGCTTCTCCATCACCAACAGG - Intergenic
1039197884 8:35052591-35052613 CCAGTTTCTCCCACTTGAAATGG - Intergenic
1041409227 8:57535114-57535136 CAAGCTACTTCCAAACCAAATGG - Intergenic
1044051893 8:87515656-87515678 CCAATTTCTCCCACATGAAATGG + Intronic
1044607265 8:94058203-94058225 CAAGCCTATTCCACACGACAGGG - Intergenic
1045793124 8:106009856-106009878 CATGAATATCCCACACGAAATGG - Intergenic
1046132903 8:109990352-109990374 CAGGCTTCTCCCCCATGCAAAGG + Intergenic
1046777895 8:118183203-118183225 AAAGTTCCTCCCACAGGAAAAGG - Intergenic
1052969348 9:34367526-34367548 CCAACTTCTCCCACTTGAAATGG - Exonic
1190974613 X:55387112-55387134 CCAGTTTCTCCCACTTGAAATGG + Intergenic
1196600722 X:117598941-117598963 CAAGCCTGTCCTACAAGAAATGG - Intergenic