ID: 1107899280

View in Genome Browser
Species Human (GRCh38)
Location 13:44995985-44996007
Sequence TGTAATCCCCAATACTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1257
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 1194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107899273_1107899280 17 Left 1107899273 13:44995945-44995967 CCCACTAAACCATGAGGAAAGGA 0: 1
1: 0
2: 3
3: 23
4: 432
Right 1107899280 13:44995985-44996007 TGTAATCCCCAATACTAGCAGGG 0: 1
1: 0
2: 4
3: 58
4: 1194
1107899271_1107899280 18 Left 1107899271 13:44995944-44995966 CCCCACTAAACCATGAGGAAAGG 0: 1
1: 1
2: 0
3: 27
4: 293
Right 1107899280 13:44995985-44996007 TGTAATCCCCAATACTAGCAGGG 0: 1
1: 0
2: 4
3: 58
4: 1194
1107899274_1107899280 16 Left 1107899274 13:44995946-44995968 CCACTAAACCATGAGGAAAGGAA 0: 1
1: 0
2: 4
3: 15
4: 326
Right 1107899280 13:44995985-44996007 TGTAATCCCCAATACTAGCAGGG 0: 1
1: 0
2: 4
3: 58
4: 1194
1107899276_1107899280 -7 Left 1107899276 13:44995969-44995991 CCACGTCCTAAGCCTCTGTAATC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1107899280 13:44995985-44996007 TGTAATCCCCAATACTAGCAGGG 0: 1
1: 0
2: 4
3: 58
4: 1194
1107899275_1107899280 8 Left 1107899275 13:44995954-44995976 CCATGAGGAAAGGAACCACGTCC 0: 1
1: 0
2: 7
3: 40
4: 318
Right 1107899280 13:44995985-44996007 TGTAATCCCCAATACTAGCAGGG 0: 1
1: 0
2: 4
3: 58
4: 1194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107899280 Original CRISPR TGTAATCCCCAATACTAGCA GGG Intronic
900279138 1:1854648-1854670 TGTAATCCCACCTACTAGCGAGG + Intronic
900355901 1:2263357-2263379 TGTAATCCCTACTACTTGGAAGG - Intronic
900718478 1:4160086-4160108 TATAATCCCCACTACTAGGGAGG + Intergenic
901147461 1:7075782-7075804 TGTAATCCCAACTACTCGGAAGG - Intronic
901247345 1:7742948-7742970 TGTAATCCCAGATACTAGAGAGG - Intronic
901540699 1:9913459-9913481 TGTAATCCCAGCTACTAGGAAGG - Intergenic
901607086 1:10467630-10467652 TGTAATCCCAGCTACTTGCAAGG - Intronic
901824086 1:11849177-11849199 TGTAATCCCCGCTACTAGGGAGG + Intergenic
901826860 1:11867653-11867675 TGTAATCCCAGCTACTTGCAAGG + Intergenic
901850983 1:12015329-12015351 TGTAATCCCAGATACTAGGGTGG + Intergenic
901985806 1:13074357-13074379 TGTAATCCCAGCTACTTGCAAGG + Intronic
901996003 1:13152410-13152432 TGTAATCCCAGCTACTTGCAAGG - Intergenic
902229601 1:15019508-15019530 TGTAATCCCAGATACTAGGGAGG - Intronic
902294350 1:15456236-15456258 TGTAATCCCAACTACTAGGGAGG + Intergenic
902407868 1:16195964-16195986 TGTAATCCCCACTACTCGGGAGG + Intergenic
902408759 1:16200777-16200799 TGTAATCCCAGCTACTCGCAAGG + Intronic
903075884 1:20765841-20765863 TGTAATCCCAGATACTTGGAAGG + Intronic
903370845 1:22835009-22835031 TGTCATCGCCAATCCTGGCAAGG - Intronic
903382072 1:22904169-22904191 TGTAATCCCAACTACTTGGAAGG + Intronic
903437141 1:23358896-23358918 TGTAATCCCCATTACTCGGGAGG - Intergenic
903525276 1:23988768-23988790 TGTAGTCCCCCCTACTAGGAAGG + Intergenic
903598405 1:24514845-24514867 TGTAATCCCAGCTACTCGCAGGG + Intronic
904084480 1:27895298-27895320 TGTAATCCCAGATACTGGCGAGG + Intronic
904129028 1:28261900-28261922 TGTAATCCCAACTACTAGGGAGG - Intronic
904132258 1:28283634-28283656 TGTAATCCCAGCTACTAGGAAGG - Intergenic
904193229 1:28764069-28764091 TGTAATCCCAGCTACTAGGAAGG - Intronic
904275452 1:29381170-29381192 TGTAATCCCAGCTACTAGAAAGG + Intergenic
904531488 1:31172648-31172670 TGTAATCCCAGATACTAGGGAGG + Intergenic
904635404 1:31877063-31877085 TGTAATCCCAGATACTGGGAAGG - Intergenic
904693196 1:32310454-32310476 TGTAATCCCAGCTACTAGCAAGG + Intronic
905193264 1:36252783-36252805 TGTAATCCCAGCTACTTGCAAGG + Intronic
905360614 1:37417099-37417121 TGTAATCCCAGCTACTTGCAAGG + Intergenic
905572981 1:39020979-39021001 TGTAATCCCAAATACTTGGGAGG - Intergenic
905622965 1:39464790-39464812 TGTAATCCCAACTACTAGGGAGG + Intronic
905671488 1:39793489-39793511 TGTAATCCCAGATACTTGGAAGG + Intergenic
905725172 1:40245388-40245410 TGTAATCCCAGATACTAGGGAGG + Intergenic
905926478 1:41753544-41753566 TGTAATCCCAACTACTTGGAAGG + Intronic
906413462 1:45599248-45599270 TGTAGTCCCCGTTACTCGCAAGG - Intronic
906426318 1:45716364-45716386 TGTAATCCCAACTACTAGGGAGG - Intronic
906473304 1:46149298-46149320 TGTAATCCCAAATACTTGGGAGG + Intronic
906573373 1:46863756-46863778 TGTAATCCCAGATACTTGGAAGG + Intergenic
906621048 1:47279605-47279627 TGTAATCCCAGCTCCTAGCAGGG + Intronic
906624982 1:47317649-47317671 TGTAATCCCGACTACTAGGGAGG + Intergenic
906816101 1:48881231-48881253 TGTAATCCCACATGCTGGCAAGG - Intronic
907066268 1:51486301-51486323 TGTAATCCCAGCTACTAGGAAGG + Intronic
907322744 1:53615868-53615890 TGTAATCCCAACTACTCGGAAGG - Intronic
907902371 1:58752586-58752608 TGTAATCCCAGCTACTAGGAAGG - Intergenic
907966410 1:59334262-59334284 TGTAGTCCCAAATACTAGGGAGG - Intronic
908228608 1:62081687-62081709 TGTAATCCCAACTACTAGGAAGG - Intronic
908239205 1:62174651-62174673 TGTAATCCCAACTACTAGGGAGG + Intergenic
908373636 1:63510066-63510088 TGTAATCCCAACTACTCCCAAGG + Exonic
908404992 1:63805895-63805917 TGTAGTCCCAAATACTAGGAAGG + Intronic
908469597 1:64430768-64430790 TGTAATCCCAACTACTAGGGAGG - Intergenic
908791778 1:67789908-67789930 TCAAAGCCCCAAAACTAGCATGG - Intronic
909988205 1:82188619-82188641 TGTAATCCCAACTACTGGAAAGG - Intergenic
911005014 1:93211154-93211176 TGTAATCCCCACTACTTGGGAGG + Intronic
911080804 1:93928351-93928373 TGTAATCCCCAGTGTTAGAATGG + Intergenic
911092460 1:94028786-94028808 TGTAATCCCCACTACTCGGGGGG + Intronic
911343078 1:96662882-96662904 TGTAATCCCAGATACTGGAAAGG - Intergenic
911502918 1:98711136-98711158 TGTAATCCCCACTACTTGGGAGG - Intronic
911888743 1:103340099-103340121 TGTAATCCCTAAAAGAAGCATGG + Intergenic
912638548 1:111321468-111321490 TGTAATCCCAGATACTTGGAAGG - Intergenic
912791639 1:112657711-112657733 TGTAATCCCAACTACTAGAGAGG - Intronic
912834965 1:112987970-112987992 TGTAATCCCAACTACTGGGAAGG + Intergenic
913020447 1:114784159-114784181 TGTAATCCCAAATACTTGGGAGG - Intergenic
913043671 1:115054863-115054885 TGTAATCCCAGCTACTAGCGGGG + Intronic
913104911 1:115604954-115604976 TGTAATTCCCACTACTTGGAAGG + Intergenic
913297062 1:117332367-117332389 TGTAATCCCATATACTCGGAAGG + Intergenic
913462152 1:119098856-119098878 TGTAATCCCAACTACTCGGAAGG - Intronic
913462786 1:119105787-119105809 TGTAATCCCAGCTACTAGGAAGG + Intronic
913554678 1:119953187-119953209 TGTAATCCCAACTACTAGGGAGG + Intronic
913720908 1:121593747-121593769 TGTAATCCCCGCTACTAGGGAGG - Intergenic
914213889 1:145607332-145607354 TGTAATCCCAACTACTAGGGAGG - Intergenic
914224906 1:145712244-145712266 TGTAATCCCAACTACTAGGGAGG + Intergenic
914465834 1:147927735-147927757 TGTAATCCCAACTACTAGGGAGG - Intergenic
914682458 1:149948491-149948513 TGTAATCCCAACTACTAGGGAGG - Intronic
914687665 1:149995455-149995477 TGTAATCCCAACTACTAGGAAGG + Intronic
914701258 1:150136125-150136147 TGTAATCCCAGCTACTAGCAGGG + Intronic
914730541 1:150365709-150365731 TGTAATCCCGACTACTCGCGAGG - Intronic
914778198 1:150758169-150758191 TGTAATCCCAGATACTCGGAAGG - Intronic
914795792 1:150919113-150919135 TGTAATCCCAGCTACTAGGAAGG + Intergenic
914868933 1:151457803-151457825 TGTAATCCCAGCTACTAGGAAGG + Intronic
915126116 1:153666303-153666325 TGTAATCCCCACTACTTGGGAGG - Intronic
915202681 1:154244492-154244514 TGTAATCCCAGATACTAGGGAGG - Intronic
915362388 1:155294009-155294031 TGTAATCCCCACTACTTGGGAGG + Intronic
915400866 1:155620711-155620733 TGTAATCCCAGCTACTAGCAGGG - Intergenic
915506532 1:156360466-156360488 TGTAATCCCAGCTACTAGCAGGG - Intronic
915533606 1:156519590-156519612 TGTAATCCCAGCTACTAGGAAGG - Intergenic
915717873 1:157961545-157961567 TGTAATCCCAATTACTAGGGAGG + Intergenic
915836377 1:159179544-159179566 TATACTCCCAAATACTGGCAAGG + Intronic
915965117 1:160300216-160300238 TGTAATCCCAACTACTCGGAAGG + Intronic
916054301 1:161057514-161057536 TGTAATCCCCACTACTCAGAAGG + Intronic
916371046 1:164094637-164094659 TGTATTTCTAAATACTAGCAAGG + Intergenic
916540929 1:165753349-165753371 TGTAATCCCAGCTACTTGCAAGG + Intronic
916544048 1:165785358-165785380 TGTAGTCCCAGCTACTAGCAGGG - Intronic
916969318 1:169993761-169993783 TGTAATCCCAGGTACTAGGAAGG + Intronic
917393912 1:174570764-174570786 GGCAATACCCAATGCTAGCAAGG + Intronic
917407384 1:174722051-174722073 TGTAATCCCAACTACTAGGGAGG - Intronic
917558655 1:176120296-176120318 TGTAATCCCAGATACTAGGGAGG + Intronic
917850672 1:179061198-179061220 TGTAATTCCAAATACTCGGAAGG - Intronic
918453977 1:184688173-184688195 TATAATCCCAACTACTAGGATGG + Intergenic
918706464 1:187668736-187668758 TGTAATCCCAACTACTTGGAAGG + Intergenic
918734104 1:188037334-188037356 TGTAATCCCAACTACTCGGAAGG - Intergenic
918940082 1:190982421-190982443 TGTAATCCCAAATACTTGGGAGG - Intergenic
919158914 1:193803441-193803463 TTTAATCCCAAATTCCAGCATGG + Intergenic
919207099 1:194431778-194431800 TGTAATCCCAACTACTCGGAAGG + Intergenic
919678890 1:200413878-200413900 TGTAATCCCAGCTACTAGGAAGG + Intergenic
920001122 1:202799529-202799551 TGTAATCCCAGCTACTAGGAAGG + Intronic
920321548 1:205127380-205127402 TCTAATCCCCACTACTAGGGGGG + Intergenic
920773641 1:208914229-208914251 TGTAATCCCAGATACTCGGAAGG + Intergenic
921211388 1:212902519-212902541 TGTAATCCCCACTACTTGGGAGG - Intergenic
921572018 1:216791150-216791172 TGTAATCCCCAGTGCTGGAAGGG + Intronic
921643933 1:217590140-217590162 TGTAATCCCAGCTACTAGGAAGG - Intronic
922177288 1:223206499-223206521 TGTAATCCCCACTACTTGGGAGG + Intergenic
922247896 1:223818380-223818402 TGTAATCCCAACTACTCGGAAGG + Intronic
922282041 1:224135488-224135510 TCTAATCCCAGATACTTGCAAGG + Intronic
923190479 1:231615568-231615590 TGTAATCCCAGCTACTAGGAAGG - Intronic
923626648 1:235619273-235619295 TGTAGTCCCAAATACTTGCAGGG + Intronic
923683078 1:236135065-236135087 TGTAATCCCCACTACTTGGGAGG - Intergenic
923749899 1:236737882-236737904 TGTTTTCCCAAATACAAGCATGG + Intronic
923754891 1:236783171-236783193 TGTAATCCCAACTACTGACAAGG + Intergenic
923903509 1:238355939-238355961 TGTAATCCCAACTACTCGGAAGG + Intergenic
924229771 1:241953699-241953721 TGTAGTCCCAACTACTTGCAAGG - Intergenic
924364120 1:243271662-243271684 TGTAAACCCAAATACTAGGGAGG - Intronic
924925776 1:248678092-248678114 TGTTATCCCCTAAAGTAGCAGGG - Intergenic
1063405177 10:5787380-5787402 TGTAATCCCAACTACTTGGAAGG + Intronic
1063595887 10:7435263-7435285 TGTAATCCCAACTACTTGGAAGG - Intergenic
1063761705 10:9086024-9086046 TGTAATCCCAGATACTAGGGAGG + Intergenic
1063888471 10:10604086-10604108 TGTAGTCCCCACTACTAGGGAGG + Intergenic
1063990256 10:11553772-11553794 TGTAATCCCAACTACTCGCGAGG + Intronic
1064085597 10:12344113-12344135 TGTAATCCCAATTACTAGGGAGG - Intergenic
1064093348 10:12404165-12404187 TGTAATCCCAACTACTGGGAAGG - Intronic
1064099090 10:12447971-12447993 TGTAATCCCAAATACTTGGGAGG - Intronic
1064144508 10:12816748-12816770 TGTAATCCCAGCTACTCGCAAGG + Intronic
1064399201 10:15006826-15006848 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1064401490 10:15025023-15025045 TGTAATCCCCGCTACTAGGGAGG + Intergenic
1064443803 10:15375843-15375865 TGTAATCCCAGCTACTAGAAAGG - Intergenic
1064483251 10:15760539-15760561 TGTAATCCCAGATACTAGGGAGG - Intergenic
1064704930 10:18061748-18061770 TGTAATCCCAAGTACTCGGAAGG + Intergenic
1064713737 10:18153701-18153723 TGTAATCCCAGCTACTCGCAAGG - Intronic
1064760832 10:18618558-18618580 TGTAATCCCAGATACTTGGAAGG + Intronic
1065175397 10:23070375-23070397 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1065336681 10:24659435-24659457 TGTAATCCCAGCTACTCGCAAGG - Intronic
1065504982 10:26421138-26421160 TGTAATCCCAGGTACTTGCAAGG + Intergenic
1065514465 10:26511220-26511242 TGTAATCCCAACTACTAGGAAGG + Intronic
1065713334 10:28538458-28538480 TGTAATCCCAACTACTAGGGAGG + Intronic
1065791485 10:29264528-29264550 TGTAATCCCAGCTACTAGCGTGG + Intergenic
1066290793 10:34012789-34012811 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1066399984 10:35067025-35067047 TGTAATCCCAGATACTAGGGAGG + Intronic
1067938452 10:50631513-50631535 TGTAATCCCCACTACTCGGGAGG + Intergenic
1068229361 10:54151417-54151439 TGTAGTCCCCACTACTAGTGAGG + Intronic
1069215536 10:65814385-65814407 TGTAATCCCCGCTACTTGGAAGG - Intergenic
1069237577 10:66096643-66096665 TGTAATCCCAGCTACTAGGAAGG - Intronic
1069290937 10:66778852-66778874 TGTAATCCCAACTACTTGCGAGG + Intronic
1069526747 10:69179343-69179365 TGTAATCCCAATTACTAGGGAGG - Intergenic
1069896036 10:71680624-71680646 TGTAATCCCAGATACTCGGAAGG + Intronic
1070058286 10:72955797-72955819 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1070099772 10:73373870-73373892 TGTAATCCCCACTACTCGGGAGG + Intergenic
1070146477 10:73777674-73777696 TGTAATCCCCACTACTAGGGAGG - Intronic
1071275311 10:84048852-84048874 TGTAATCCCAGCTACTAGCGAGG + Intergenic
1071303699 10:84278002-84278024 TGTAATCCCAACTACTAGGGAGG + Intergenic
1071363040 10:84869935-84869957 TGTAATCCCCACCCCCAGCAAGG - Intergenic
1071593723 10:86901978-86902000 TGTAATCCCAGTTACTTGCAAGG - Intronic
1071596753 10:86933546-86933568 TGTAATCCCCACTACTCGGGAGG - Intergenic
1071705520 10:87993896-87993918 TGTAATCCCAGTTACTAGGAAGG + Intergenic
1071769723 10:88713817-88713839 TGTAATCCCAGCTACTTGCAGGG + Intergenic
1072123833 10:92428276-92428298 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1072236853 10:93460971-93460993 TGTAATCCCCGATACTCGGGTGG + Intronic
1072241940 10:93504931-93504953 TGTAATCCCAAATACTTGGGAGG - Intronic
1072584967 10:96773471-96773493 TGTAATCCCAGTTACTTGCAAGG + Intergenic
1073211957 10:101811265-101811287 TGTAATCCCAACTACTAGGGAGG + Intronic
1073333243 10:102685125-102685147 TGTAATCCCAGCTACTTGCAAGG + Intronic
1073790750 10:106937840-106937862 TGTAATCCCCACTACTTGGGAGG + Intronic
1073826790 10:107333189-107333211 TGTAATCCCAACTACTAGGGAGG - Intergenic
1074157964 10:110814615-110814637 TGTAATCCCAAATACTAAGGAGG - Intronic
1074284354 10:112084147-112084169 TGTAATCCCAGATACTAGGAAGG - Intergenic
1074484764 10:113864573-113864595 TGTAATCCCAACTACTAGGGAGG + Intronic
1074517126 10:114180585-114180607 TGTAATCCCAGCTACTAGGAAGG - Intronic
1075036877 10:119076812-119076834 TGTAATCCCAAATACTCGGGAGG + Intronic
1075081705 10:119388456-119388478 TGTAATCCCAGCTACTAGGATGG - Intronic
1075200878 10:120402939-120402961 TGTAATCCCAACTACTAGGGAGG + Intergenic
1075470111 10:122682436-122682458 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1075492510 10:122884651-122884673 TGTAATCCCAACTACTAGGGAGG - Intergenic
1075812779 10:125237711-125237733 TGTAATCCCCACTACTTGGGAGG + Intergenic
1075886774 10:125906392-125906414 TGTAATCCCAGCTACTAGCGAGG + Intronic
1075888061 10:125919325-125919347 TGTAATCCCAGCTACTAGCGAGG - Intronic
1077067762 11:651082-651104 TGTAATCCCAGCTACTAGCGGGG - Intronic
1077180558 11:1210946-1210968 TGTAATCCCAGATACTTGGAAGG + Intergenic
1077622457 11:3739368-3739390 TGTAATCCCACCTACTCGCAAGG - Intronic
1077623854 11:3752393-3752415 TGTAATCCCAGCTACTAGGAAGG + Intronic
1078205323 11:9224070-9224092 TGTAATCCCAACTACTAGGGAGG + Intronic
1079816252 11:25062466-25062488 TGTACTCCCAAATACTTGAAGGG + Intronic
1080473264 11:32566818-32566840 TGTAATCCCAGATACTAGGGAGG - Intergenic
1080595056 11:33765650-33765672 TGTAATCCCCAATATTGGAGGGG + Intronic
1080664343 11:34322451-34322473 TGTAATCCCAGCTACTAGGAAGG + Intronic
1081150650 11:39626690-39626712 TTTAAGCCCCAATTCCAGCAGGG + Intergenic
1081704031 11:45170219-45170241 TGTAATCCCAGCTACTAGGAAGG + Intronic
1081744350 11:45462535-45462557 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1082024461 11:47562102-47562124 TGTAATCCCAGATACTAGGGAGG + Intronic
1082094457 11:48117417-48117439 TGTAATCCCAGCTACTAGGAAGG + Intronic
1082752558 11:57034879-57034901 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1082860050 11:57846973-57846995 TGTAATCCCAACTACTTGGAAGG - Intergenic
1083026116 11:59552460-59552482 TGTAATCCCAGCTACTAGGAGGG + Intergenic
1083455116 11:62773567-62773589 TGTAATCCCAGCTACTCGCAAGG - Intronic
1083468360 11:62864586-62864608 TGTAATCCCAGCTACTCGCAAGG - Intronic
1083596958 11:63922472-63922494 TGTAATCCCCACTACTCGGGAGG - Intergenic
1083791248 11:64987546-64987568 TGTAATCCCCACTACTTGGGAGG + Intergenic
1083822141 11:65178695-65178717 TGTAGTCCCCACTACTAGGGAGG - Intronic
1083867426 11:65464236-65464258 TGTAATCCCAACTACTAGGGAGG - Intergenic
1084078002 11:66797119-66797141 TGTAATCCCAGCTACTAGGAAGG - Intronic
1084198100 11:67537393-67537415 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1085142210 11:74156338-74156360 TGTAGTCCCCACTACTAGGGAGG + Intronic
1085584166 11:77685415-77685437 TGTAATCCCAGCTACTTGCAAGG - Intronic
1086020326 11:82220560-82220582 TGTATTCCCCAAATCCAGCATGG - Intergenic
1086457361 11:86972454-86972476 TGTAATCCCCACTACTCGGGAGG + Intergenic
1086484019 11:87277641-87277663 TGTAATCCCAATTACTAGGGAGG - Intronic
1086721023 11:90120829-90120851 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1087015644 11:93552259-93552281 TGTAATCCCAATTACTTGGAAGG - Intergenic
1087040931 11:93799295-93799317 TGTAATCCCAAATACTTGGGAGG - Intronic
1087209334 11:95430674-95430696 TGTAGTCCCCACTACTACCAAGG - Intergenic
1087242858 11:95799618-95799640 TGTAATCCCCACTATTAGTCCGG + Intronic
1087745937 11:101946736-101946758 TGTAATCCCAACTACTAGGAAGG + Intronic
1087783436 11:102326828-102326850 TGTAATCCCAGCTACTAGCGAGG - Intronic
1087820909 11:102710839-102710861 TGTAGTCCCAAATACTTGAAAGG + Intergenic
1087890612 11:103533558-103533580 TGTAATCCCAACTACTTGGAAGG - Intergenic
1088237710 11:107742867-107742889 TGTAATCCCAGCTACTAGAAAGG + Intergenic
1088253232 11:107879794-107879816 TGTAATCCCAGATACTTACAAGG - Intronic
1088310412 11:108454418-108454440 TGTAATCCCAACTACTCGGAAGG - Intronic
1088493699 11:110411702-110411724 TGTAATCCCAACTACTAGGGAGG + Intergenic
1088638216 11:111845180-111845202 TGTAATCCCAGCTACTAGGAAGG + Intronic
1089724678 11:120465586-120465608 TGTAATCCTAACTACTAGGAAGG - Intronic
1089931513 11:122317975-122317997 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1089962517 11:122628311-122628333 TGTAATCCCAACTACTAGGGAGG + Intergenic
1090622094 11:128569250-128569272 TGAAAACCCCAATACTCTCATGG + Intronic
1091873623 12:3915814-3915836 TGTAATCCCAACTACTCGGAAGG - Intergenic
1092254495 12:6918858-6918880 TGTAATCACAGATACTAGCGGGG + Intronic
1092351426 12:7759041-7759063 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1092360686 12:7833657-7833679 TGTAATCCCAGCTACTAGGAGGG + Intronic
1092484252 12:8888520-8888542 TGTAATCCCAACTACTAGAGAGG - Intergenic
1092487953 12:8919179-8919201 TGTAATCCCAACTACTAGGGAGG - Intronic
1092604589 12:10104455-10104477 TGTAATCCCCACTACTTGGGAGG + Intronic
1092613818 12:10198373-10198395 TGTAATCCCAACTACTAGGGAGG - Intergenic
1092680223 12:10970684-10970706 TGTAATCCCAACTACTAGGGAGG - Intronic
1092886550 12:12929499-12929521 TGTAATCCCAGATACTAGGGAGG - Intergenic
1093161371 12:15751234-15751256 TGTAATCCCAGCTACTAGCAAGG + Intronic
1093211737 12:16316345-16316367 TGTAATCCCCACTACTTGTCTGG + Intergenic
1093453247 12:19339160-19339182 TGTAATCCCAGCTACTAGGAAGG - Intronic
1094442751 12:30497540-30497562 TGTAATCCCAGCTACTAGGAGGG - Intergenic
1094780055 12:33780715-33780737 GGTAATACCCAATGCTGGCAAGG - Intergenic
1095475095 12:42578881-42578903 TGTAATCCCAGCTACTCGCAAGG - Intronic
1096056638 12:48658107-48658129 TGTAATCCCAACTACTCGGAAGG + Intronic
1096083527 12:48849538-48849560 TGTAATCCCAGATACTCGGAAGG + Intronic
1096117368 12:49062750-49062772 TGTAATCCCAATTACTAGGGAGG - Intergenic
1096406820 12:51350023-51350045 TGTAATCCCAGCTACTCGCAAGG - Intergenic
1096619981 12:52858336-52858358 TGTAATCCCACCTACTAGCGAGG + Intergenic
1097044429 12:56176941-56176963 TGTAATCCCAACTACTAGGGAGG - Intronic
1097094185 12:56532418-56532440 TGTAATCCCAGATACTAGAGAGG + Intronic
1097095678 12:56546055-56546077 TGTAATCCCAACTACTCGGAAGG - Intronic
1097388902 12:58984894-58984916 TGTAATCCCAGCTACTAGGAGGG - Intergenic
1097483568 12:60163981-60164003 TGTAGTCCCAAATACTTGGAAGG - Intergenic
1097780098 12:63692532-63692554 TGTAATCCCCACTACTCGGGAGG + Intergenic
1098933682 12:76451993-76452015 TGTAATCCCAACTACTAGGGAGG + Intronic
1099172756 12:79385106-79385128 TGTAATCCCAACTACTAGAGAGG - Intronic
1100494519 12:95112110-95112132 TGTAATCCCAACTACTTGGAGGG + Intronic
1100801506 12:98236037-98236059 TGTAATCCCAACTACTTGGAAGG + Intergenic
1100809897 12:98327493-98327515 TGTAATCCCCGCTACTAGGGAGG - Intergenic
1101102134 12:101404991-101405013 TGTAATCCCAACTACTCGGAAGG - Intronic
1101617741 12:106354655-106354677 TGTAATCCCAAATACTCGGGAGG - Intergenic
1101658803 12:106748053-106748075 TGTAATCCCCACAACAACCAGGG + Intronic
1101859982 12:108475126-108475148 TGTAATCCCAACTACTAGGGAGG + Intergenic
1101936205 12:109059633-109059655 TGTAATCCCAGATACTAGGGAGG - Intronic
1101951697 12:109181347-109181369 TGTAATCCCAACTACTAGGGAGG - Intronic
1101954376 12:109200303-109200325 TGTAATCCCAACTACTTGGAAGG - Intronic
1101983424 12:109427192-109427214 TGTAATCCCCACTACTTGGGAGG + Intronic
1102060201 12:109925951-109925973 TGTAATCCCAGCTACTCGCAAGG - Intronic
1102062404 12:109943454-109943476 TGTAATCCCAGATACTTGGAAGG - Intronic
1102174127 12:110863660-110863682 TGTAATCCCAACTACTAGGGAGG - Intronic
1102305160 12:111799285-111799307 TGTAATCCCAGCTACTAGTAGGG - Intronic
1103087181 12:118070424-118070446 TGTAATCCCAACTACTCGGAAGG + Intronic
1103096027 12:118133138-118133160 TGTAATCCCAGCTACTAGGAAGG - Intronic
1103120294 12:118374260-118374282 TGTAATCCCAGCTACTAGAAAGG + Intergenic
1103434187 12:120912058-120912080 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1103594106 12:122012931-122012953 TGTAATCCCAGATACTTGGAAGG + Intergenic
1103652785 12:122445905-122445927 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1104119358 12:125784194-125784216 TGTAATCCCCACTACTCGGGAGG + Intergenic
1104511690 12:129385225-129385247 TGTAATCCCCACTACTCGGGAGG - Intronic
1104538739 12:129643044-129643066 TGTAATCCCAACTACTAGGGAGG - Intronic
1105265970 13:18815842-18815864 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1105361765 13:19725053-19725075 TGTAATCCCAGATACTCGGAAGG + Intronic
1105698021 13:22909831-22909853 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1105781346 13:23707280-23707302 TGTAATCCCCGCTACTCGGAAGG - Intergenic
1106435243 13:29717737-29717759 TGTAATCCCAGATACTCGGAAGG + Intergenic
1107110221 13:36689381-36689403 TGTAATCCCCGCTACTAGGGAGG + Intronic
1107296049 13:38909024-38909046 TGTAATCCCCACTACTGGGGAGG - Intergenic
1107546512 13:41438478-41438500 TGTAATCCCAACTACTTGGAAGG + Intergenic
1107643459 13:42469275-42469297 TGTAATCCCAGATACTTGGAAGG + Intergenic
1107899280 13:44995985-44996007 TGTAATCCCCAATACTAGCAGGG + Intronic
1110002854 13:70228027-70228049 TGTAATCCCAACTACTAGGGAGG - Intergenic
1110350105 13:74496910-74496932 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1110895326 13:80743873-80743895 TGTAATCCCAGCTACTAGCGGGG + Intergenic
1110910035 13:80947898-80947920 TGTAATCCCAGATACTAGGGAGG + Intergenic
1110995872 13:82108795-82108817 TGTAATCCCAGATACTAGAGAGG + Intergenic
1111270367 13:85874281-85874303 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1111383737 13:87495459-87495481 TGTAATCCCTGCTACTAGGAAGG - Intergenic
1111809671 13:93083493-93083515 TGTAATCCCAAATACTAGGGAGG + Intergenic
1112350021 13:98625198-98625220 TGTAATCCCAGCTACTTGCACGG + Intergenic
1113519386 13:110928599-110928621 GGTAATACCCAATATTAGCCAGG - Intergenic
1114280844 14:21191622-21191644 TGTAATCCCAGCTACTCGCAAGG + Intergenic
1114295605 14:21326489-21326511 TGTAATCCCAGCTACTAGCCTGG - Intronic
1114599157 14:23940467-23940489 TGTAATCCCAAATACTCGGGAGG - Intergenic
1114633788 14:24176176-24176198 TGTAATCCCAGCTACTAGGAAGG - Intronic
1114667420 14:24387617-24387639 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1115024941 14:28733103-28733125 TGTAGTCCCCAATACTCGGGAGG + Intergenic
1115340663 14:32290464-32290486 TGTAATCCCAGCTACTAGAATGG + Intergenic
1115563765 14:34606895-34606917 TGTAATCCCAGATACTTGGAAGG - Intronic
1115866598 14:37754552-37754574 TGTAATCCCAACTACTCGGAAGG - Intronic
1115988692 14:39128992-39129014 TGTAATCCCAACTACTAGGGAGG + Intronic
1116011940 14:39361558-39361580 TGTAATCCCAGATACTCACAAGG - Intronic
1116254620 14:42535546-42535568 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1116455747 14:45118976-45118998 TGTAATCCCAACTACTAGGGAGG - Intronic
1118072780 14:62264171-62264193 TGTAATCCCAACTACTTGGAAGG - Intergenic
1118831572 14:69438141-69438163 TGTAATCCCAACTACTAGGGAGG - Intronic
1118982514 14:70728241-70728263 TGTAATCCCAGCTACTCGCAAGG - Intronic
1119311259 14:73648533-73648555 TGTAGTCCCAACTACTCGCAGGG - Intronic
1119344931 14:73915457-73915479 TATAATCCCCACTACTCGGAAGG - Intronic
1119369077 14:74122742-74122764 TGTAATCCCAAATACTTGGGAGG + Intronic
1119833008 14:77720254-77720276 TGTAATCCCCACTACTTGGGAGG - Intronic
1120043097 14:79775941-79775963 TGTAGTCCCACATCCTAGCATGG + Intronic
1120107065 14:80508035-80508057 TGTAATCCCAGCTACTAGCGGGG - Intronic
1120117487 14:80636962-80636984 TGTAATCCCAGCTACTAGGAAGG + Intronic
1120197043 14:81495813-81495835 TGTAATCCCAAATACTTGGTAGG + Intronic
1120221688 14:81741524-81741546 TGTAATCCCAACTACTAGGGAGG + Intergenic
1120855343 14:89207097-89207119 TGTAATCCCCACTACTTGGGAGG + Intronic
1121020931 14:90579675-90579697 TGTAATCCCAACTACTAGGGAGG + Intronic
1121280834 14:92696562-92696584 TGTAATCCTAACTACTAGAAAGG + Intergenic
1121380539 14:93462182-93462204 TGTAATCCCAGCTACTGGCAGGG + Intronic
1121479274 14:94248668-94248690 TGAAATCACCAATTCAAGCAAGG - Intronic
1121736038 14:96218795-96218817 TGTAATCCCAGCTACTAGGAAGG + Intronic
1121772603 14:96562014-96562036 TGTAATCCCCACTACTCGGGAGG - Intronic
1121797001 14:96743484-96743506 TGTAATCCCAACTACTAGGGAGG - Intergenic
1122216671 14:100209072-100209094 TGTAATCCCAACTACTTGGAAGG - Intergenic
1122569714 14:102688086-102688108 TGTAATCCCAGCTACTCGCAGGG - Intronic
1122712170 14:103666896-103666918 TGTAATCCCAACTACTAGGGAGG - Intronic
1122965920 14:105125880-105125902 TGTAATCCCAGCTACTCGCAAGG - Intergenic
1202832539 14_GL000009v2_random:52258-52280 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1202885165 14_KI270722v1_random:99032-99054 TGTAATCCCAAATACTTGGGAGG - Intergenic
1123456574 15:20431735-20431757 TGTAATCCCAGCTACTCGCAAGG + Intergenic
1123485371 15:20730952-20730974 TGTAATCCCAGCTACTCGCAGGG + Intergenic
1123541859 15:21300001-21300023 TGTAATCCCAGCTACTCGCAGGG + Intergenic
1123587663 15:21773510-21773532 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1123624301 15:22216075-22216097 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1123661488 15:22568627-22568649 TGTAATCCCAGCTACTCGCAAGG - Intergenic
1123758489 15:23415292-23415314 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1123806019 15:23874254-23874276 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1123909019 15:24948690-24948712 AGTAATCCCCAAAACTGTCAAGG - Intronic
1124262717 15:28206887-28206909 TGTAATCCCAGCTACTCGCAAGG + Intronic
1124315288 15:28662856-28662878 TGTAATCCCAGCTACTCGCAAGG - Intergenic
1124550398 15:30675853-30675875 TGTAATCCCAGCTACTTGCAAGG + Intronic
1124930151 15:34111907-34111929 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1125571141 15:40719177-40719199 TGTAATCCCAGCTACTAGGAAGG - Intronic
1125618909 15:41041560-41041582 TGTAATCCCAACTACTAGGGAGG - Intronic
1125621188 15:41063650-41063672 TGTAATCCCAGCTACTAGGAAGG + Intronic
1125966408 15:43879057-43879079 TGTAATCCCAGCTACTCGCAGGG - Intronic
1126034655 15:44535680-44535702 TGTAATCCCCACTACTAGGGAGG - Intergenic
1126035333 15:44539880-44539902 TGTAATCCCAGCTACTAGAAAGG - Intronic
1126138164 15:45412277-45412299 TGTAATCCCAACTACTGGGAAGG + Intronic
1126524466 15:49635612-49635634 TGTAATCCCAGCTACTAGCGAGG - Intronic
1126643611 15:50853135-50853157 TGTAATCCCAGCTACTTGCAGGG + Intergenic
1126711475 15:51461670-51461692 TGTAATCCCAGCTACTTGCAGGG - Intronic
1126757983 15:51942798-51942820 TATAATCCCAACTACTAGGAAGG + Intronic
1126762968 15:51986274-51986296 TGTAATCCCCAATGTTGGCGGGG - Intronic
1126844831 15:52749137-52749159 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1126931907 15:53662945-53662967 TGTAGTCCCAAATACTTGGAAGG + Intronic
1127146628 15:56031842-56031864 TGTAATCCCAATTACTAGGGAGG - Intergenic
1127508892 15:59621002-59621024 TGTAATCCCAGCTACTTGCAAGG - Exonic
1127685001 15:61334766-61334788 TGTAATCCCAAATACTTGGGAGG + Intergenic
1128060728 15:64734099-64734121 TGTAATCCCAGATACTAGGGAGG - Intergenic
1128099450 15:64986565-64986587 TGTAATCCCAAATACTCGGGAGG + Intronic
1128102525 15:65014747-65014769 TGTAATCCCAGCTACTAGAAAGG - Intronic
1128823032 15:70679279-70679301 TGTAATCCCAGCTACTAGAAGGG + Intronic
1129378132 15:75147186-75147208 TGTAATCCCAGATACTAGGGAGG - Intergenic
1129444922 15:75610276-75610298 TGTAATCCCAGCTACTAGGAAGG + Intronic
1129602934 15:77010766-77010788 TGTAATCCCCGCTACTCGGAGGG - Intronic
1129989541 15:79950213-79950235 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1130009583 15:80140165-80140187 TGTAATCCCTACTACTAGGGAGG + Intergenic
1130237043 15:82145179-82145201 TGTAATCCCAGCTACTAGGAAGG + Intronic
1130405547 15:83597729-83597751 TGTAATCCCAAGTACTCGGAAGG - Intronic
1130416647 15:83700640-83700662 TGTAATCCCAGCTACTAGGAAGG + Intronic
1130585494 15:85177727-85177749 TGTAATTCCAACTACTAGGATGG + Intergenic
1130601461 15:85277670-85277692 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1131313307 15:91310334-91310356 TGTAATCCCAACTACTAGGGAGG - Intergenic
1131482597 15:92794751-92794773 TGTAATCCCAAATACTGGGGAGG + Intronic
1131607766 15:93926727-93926749 TGTAATCCCAGATACTTGTAAGG + Intergenic
1131903291 15:97112633-97112655 TGTAATCCCAGATACTCGGAAGG + Intergenic
1132047142 15:98573758-98573780 TGTAATCCCAGATACTAGGGAGG - Intergenic
1132179620 15:99742483-99742505 TGTAATCCCAGATACTAGGGAGG - Intergenic
1202950174 15_KI270727v1_random:27143-27165 TGTAATCCCAGCTACTCGCAGGG + Intergenic
1132909963 16:2304626-2304648 TGTAATCCCAACTACTTGGAAGG - Intronic
1132935739 16:2479952-2479974 TGTAATCCCAACTACTAGGGAGG - Intronic
1132978639 16:2723017-2723039 TGTAATCCCAGCTACTAGCGGGG - Intergenic
1133045418 16:3085886-3085908 TGTAATCCCCGCTACTAGAGGGG + Intergenic
1133063584 16:3190627-3190649 TGTAATCCCAGGTACTAGGAAGG + Intergenic
1133142884 16:3761074-3761096 TGTAATCCCAACTACTCGGAAGG - Intronic
1133147850 16:3803381-3803403 TGTAATCCCAACTACTCGGAAGG + Intronic
1133259603 16:4539561-4539583 TGTAATCCCAACTACTAGGGAGG + Intergenic
1133276655 16:4642250-4642272 TGTAATCCCCACTACTCGGGAGG - Intronic
1133476232 16:6124622-6124644 TGTAATCCTCACTACTCGGAAGG - Intronic
1133479231 16:6153655-6153677 TGTAATCCCAGCTACTAGGAAGG - Intronic
1133776899 16:8903743-8903765 TGTAATCCCAGCTACTAGGAAGG + Intronic
1133791872 16:9015354-9015376 TGTAATCCCAGATACTAGGGAGG - Intergenic
1134003981 16:10805151-10805173 TGTAATCCCCACTACTTGGGAGG - Intronic
1134284083 16:12845062-12845084 TGTAATCCCAAATACTAAGGAGG - Intergenic
1134315261 16:13113086-13113108 TGTAATCCCAGCTACTCGCAGGG + Intronic
1134457847 16:14407579-14407601 TGTAATCCCAGCTACTTGCAAGG - Intergenic
1134487599 16:14670625-14670647 TGTAATCCCAACTACTCGGAAGG + Intergenic
1134617031 16:15659556-15659578 TGTAATCCCCACTACTCGGGAGG - Intronic
1134677552 16:16101288-16101310 TGTAATCCCCAGCACTTTCAAGG - Intronic
1134759613 16:16702502-16702524 TGTAATCCCCACTACTGGGGAGG - Intergenic
1134986457 16:18656699-18656721 TGTAATCCCCACTACTGGGGAGG + Intergenic
1135238250 16:20778870-20778892 TGTAATCCCAACTACTTGGAAGG - Intronic
1135430221 16:22376012-22376034 TGTAATCCCAACTACTTGGAAGG + Intronic
1135497279 16:22963698-22963720 TGTAATCCCAACTACTAGGGAGG - Intergenic
1135537817 16:23307791-23307813 TGTAATCCCAACTGCTTGCAAGG + Intronic
1135619230 16:23940187-23940209 GGTAATGCCAAATTCTAGCAAGG + Intronic
1135714084 16:24745873-24745895 TGTAGTTCCCCAAACTAGCATGG - Intronic
1135813597 16:25611762-25611784 TGTAATCCCCACTACTCGGGAGG - Intergenic
1135841911 16:25884685-25884707 TGTAATCCCCACTACTCGGGAGG - Intronic
1136566034 16:31070981-31071003 TGTAATCCCAAATACTTGGGAGG - Intronic
1137259901 16:46817564-46817586 TGTAATCCCAACTACTAGGGAGG + Intronic
1137281501 16:46980740-46980762 TGTAATCCCCACTACTTGGGAGG - Intergenic
1138253811 16:55533532-55533554 TGTAATCCCCACTACTCGGGAGG - Intronic
1138428899 16:56955162-56955184 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1138462894 16:57163041-57163063 TGTAATCCCAAATACTCGGGAGG + Intronic
1138463996 16:57173505-57173527 TGTAATCCCAACTACTCGGAAGG + Intronic
1138818122 16:60226348-60226370 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1138861453 16:60763291-60763313 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1138902285 16:61287368-61287390 TGTAGTCCCAAATACTTGGAGGG + Intergenic
1139443417 16:66980634-66980656 TGTAATCCCAGATACTTGCCAGG - Intergenic
1139459697 16:67111743-67111765 TGTAATCCCAGCTACTAGTAGGG - Intronic
1139524962 16:67509624-67509646 TGTAGTCCCCACTACTAGGGAGG + Intergenic
1139606186 16:68020367-68020389 TGTAATCCCAAATACTTGGGAGG - Intronic
1139610310 16:68052018-68052040 TGTAGTCCCCACTACTTGGAAGG - Intronic
1139740702 16:69032754-69032776 TGTAATCCCCACTACTGGGGAGG + Intronic
1139827553 16:69769193-69769215 TGTAATCCCCGCTACTCGGAAGG + Intronic
1139902253 16:70337197-70337219 TGTAATCCCAGCTACTAGGAAGG + Intronic
1140196814 16:72861891-72861913 TGTAATCCCAACTACTAGGGAGG + Intronic
1140354562 16:74294177-74294199 TGTAATCCCAGATACTTGGAAGG - Intergenic
1140389431 16:74572387-74572409 TGTAATCCCAGCTACTCGCAAGG + Intronic
1140535208 16:75703603-75703625 TGTAATCCCAACTACTCGGAAGG - Intronic
1140825539 16:78702527-78702549 TGTAATCCCAAATGCTTGCTCGG + Intronic
1140849645 16:78923101-78923123 TGTAATCCCAGCTACTCGCAAGG - Intronic
1140921105 16:79539379-79539401 TGTAATCCCAACTACTAGAGGGG + Intergenic
1141097573 16:81173806-81173828 TGTAATCCCCACTACAACCCTGG - Intergenic
1141505249 16:84472586-84472608 TGTAATCCCCACTACTTGGGAGG + Intergenic
1141550903 16:84806135-84806157 TGTAATCCCAAATACTGGGGAGG + Intergenic
1142045198 16:87920913-87920935 TGTAATCCCAACTACTTGGAAGG - Intronic
1142612297 17:1115802-1115824 TGTAATCCCCGCTACTAGGGAGG + Intronic
1142706154 17:1695878-1695900 TGTAATCCCAACTACTCGGAAGG + Intergenic
1142980949 17:3671156-3671178 TGTAATCCCAGCTACTAGGAAGG + Exonic
1143040395 17:4031192-4031214 TGTAATCCCAACTACTTGGAAGG + Intronic
1143041028 17:4036608-4036630 TGTAATCCCAGCTACTAGGAAGG + Intronic
1143121509 17:4610562-4610584 TGTAGTCCCCATTACTTGGAAGG + Intergenic
1143253456 17:5538990-5539012 TGTAATCCCAGCTACTTGCAGGG - Intronic
1143698329 17:8637514-8637536 TGTAATCCCAGATACTCGCGGGG + Intergenic
1143789090 17:9279177-9279199 TGTAATCCCAAATACTTGGGAGG - Intronic
1144030436 17:11316540-11316562 TGTAATCCCCATTACTTGGGAGG - Intronic
1144165458 17:12605697-12605719 TGTAATCCCAGATACTAGGGAGG + Intergenic
1144517285 17:15927523-15927545 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1144529143 17:16019209-16019231 TGTAATCCCCACTACTCGGGAGG + Intronic
1144663941 17:17089587-17089609 TGTAATCCCAGATACTCGAAAGG - Intronic
1144791900 17:17864631-17864653 TGTAATCCCAACTACTAGGGGGG - Intronic
1145166852 17:20620428-20620450 TGTAATCCCCACTACTCGGAAGG - Intergenic
1146025974 17:29321351-29321373 TGTAATCCCAGTTACTTGCAAGG - Intergenic
1146130559 17:30270378-30270400 TGTAATCCCAGCTACTCGCAAGG + Intronic
1146321028 17:31846588-31846610 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1146887895 17:36484614-36484636 TGTAATCCCAACTACTAGAGAGG - Intergenic
1147054272 17:37822394-37822416 TGTAGTCCCCACTACTTGGAAGG - Intergenic
1147145281 17:38481095-38481117 TGTAATCCCAGTTACTAGCGGGG - Intronic
1147729710 17:42590843-42590865 TGTAATCCCAGCTACTAGCAGGG + Intronic
1147834540 17:43320634-43320656 TGTAATCCCCACTACTTGGGAGG - Intergenic
1148517470 17:48233732-48233754 TGTAATCCCAACTACTAGGGAGG + Intronic
1148627832 17:49083797-49083819 TGTAATCCCAACTACTCGGAAGG - Intergenic
1148886098 17:50774095-50774117 TGTAATCCCAACTACTAGGAAGG - Intergenic
1148924951 17:51075971-51075993 TGTAATCCCAGCTACTAGGAAGG + Intronic
1148932743 17:51140394-51140416 TGTAATCCCAAACACTAGGGAGG + Intergenic
1149483418 17:57022207-57022229 TGTAATCCCCACTACTTGAGAGG - Intergenic
1149814893 17:59713917-59713939 TGTAATCCCCACTGCTAGGGAGG + Intronic
1149876552 17:60239853-60239875 TGTAATCCCAACTACTTGGAAGG - Intronic
1150020183 17:61603784-61603806 TGTAATCCCAACTACTCGGAAGG - Intergenic
1150147010 17:62777595-62777617 TGTAATCCCAGATACTAGGGAGG + Intronic
1150232146 17:63560972-63560994 TGTAATCCCCACTACAGGCTGGG + Intronic
1150379316 17:64708220-64708242 TGTAATCCCAACTACTCGGAAGG - Intergenic
1150482531 17:65521598-65521620 TGTAATCCCAACTACTAGGGAGG + Intergenic
1150499869 17:65640273-65640295 TGTAATCCCAACTACTTGGAAGG - Intronic
1150672619 17:67215020-67215042 TGTAATCCCAGCTACTTGCAAGG + Intronic
1150862025 17:68810429-68810451 TGTAATCCCAGATACTCGGAAGG - Intergenic
1150896509 17:69217123-69217145 TGTAATCCCAACTACTAGGGAGG + Intronic
1151034304 17:70780161-70780183 TGGAAGCTCCATTACTAGCAAGG - Intergenic
1151778202 17:76223307-76223329 TGTAATCCCAGCTACTTGCAAGG - Intronic
1152343900 17:79740071-79740093 TGTAATCCCAGCTACTGGCAGGG + Intronic
1152345942 17:79751865-79751887 TGTAATCCCAACTACTAGGGAGG - Intergenic
1152621670 17:81368006-81368028 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1152664702 17:81560583-81560605 TGTAATCCCAGCTACTAGGAAGG + Intronic
1153004785 18:488287-488309 TGTAATCCCAATTACTAGGGAGG + Intronic
1153680335 18:7494512-7494534 TGTAGTCCCCACTACTAGGGAGG - Intergenic
1154164528 18:12004644-12004666 TGTAATCCCAGATACTTGGAAGG - Intronic
1154258995 18:12812475-12812497 TGTAATCCCAACTACTCGGAAGG + Intronic
1154422431 18:14245657-14245679 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1155045595 18:22100455-22100477 TGTAATCCCAGTTACTAGCGAGG - Intergenic
1155116445 18:22772997-22773019 TGTAATCCCAACTACTTGGAAGG + Intergenic
1155201358 18:23520579-23520601 TGTAATCCCCACTACTTGGGAGG - Intronic
1155444769 18:25899576-25899598 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1155632804 18:27914103-27914125 TGTAATCCCAGATACTAGGGAGG + Intergenic
1156046640 18:32885026-32885048 TGTAATCCCCAATGCTGGGAGGG + Intergenic
1156690693 18:39703413-39703435 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1156815513 18:41306127-41306149 TGTAATCCCAACTACTCGGAAGG + Intergenic
1157467837 18:47962971-47962993 TGTAATCCCCAATGTTGGGATGG - Intergenic
1158141911 18:54265068-54265090 TGTAATCCCAACTACTAGGGAGG - Intergenic
1158210722 18:55046857-55046879 TGTAATCCCAACTACTAGGGAGG - Intergenic
1158360439 18:56666323-56666345 TGTAATCCCAGCTACTAGAAAGG - Intronic
1158484940 18:57857906-57857928 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1158490312 18:57903955-57903977 TGTAATCCCAAATACTTGGGAGG + Intergenic
1158586557 18:58742584-58742606 TGTAATCCCAACTACTAGGGTGG + Intronic
1158691139 18:59661843-59661865 TGTAATCCCCACTACTTGGGAGG + Intronic
1159004085 18:62997655-62997677 TGTAATCCCAGCTACTTGCAAGG - Intergenic
1159035572 18:63274404-63274426 TGTAATCCCCACTACTCGGGAGG - Intronic
1159049196 18:63401869-63401891 TGTAATCCCAAATACTCGGGAGG + Intronic
1159206470 18:65259455-65259477 TGTAAACCCAAATACTAGGGAGG + Intergenic
1159771363 18:72549131-72549153 TGTAATCCCAGCTACTAGGAAGG - Intronic
1160132674 18:76242343-76242365 AGTAATCCACCATACTAACAAGG + Intergenic
1160168600 18:76534239-76534261 TGTAATCCCAGCTACTCGCAAGG - Intergenic
1160478410 18:79215809-79215831 TGTAATCCCAGCTACTCGCAAGG - Intronic
1160929668 19:1564409-1564431 TGTAATCCCACATACTAGGGGGG + Intronic
1161151515 19:2712582-2712604 TGTAATCCCAACTACTAGGGAGG - Intergenic
1161367365 19:3887991-3888013 TGTAATCCCCAGTACTCGGGAGG + Intronic
1161546605 19:4884714-4884736 TGTAATCCCAGCTACTCGCAAGG + Intergenic
1161677847 19:5662760-5662782 TGTAATCTCGAATACTAGGGAGG - Intronic
1161699273 19:5786071-5786093 TGTAATCCCAACTACTAGGGAGG - Intronic
1161928934 19:7323000-7323022 TGTAATCCCAACTACTCGCGAGG + Intergenic
1162455171 19:10779627-10779649 TGTAATCCCAAATACTTGGGAGG - Intronic
1162533105 19:11247208-11247230 TGTAATCCCCACTACTTGGGAGG - Intronic
1162752241 19:12835883-12835905 TGTAATCCCAGCTACTAGCGAGG - Intronic
1163025691 19:14510313-14510335 TGTAATCCCAACTACTCGGAAGG + Intergenic
1163311188 19:16515688-16515710 TGTAATCCCAAAAATTAGCTGGG - Intronic
1163497183 19:17653467-17653489 TGTAATCCCAGCTACTAGGAAGG - Intronic
1163501469 19:17679000-17679022 TGTAATCCCAGCTACTAGGAAGG + Intronic
1163517164 19:17771932-17771954 TGTAATCCCAACTACTAGGGAGG - Intronic
1163589846 19:18186536-18186558 TGTAATCCCAGATACTTGGAAGG + Intergenic
1163656251 19:18546915-18546937 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1163825038 19:19518683-19518705 TGTAATCCCAGATACTAGGGAGG - Intronic
1163874016 19:19851066-19851088 TGTAATCCCAACTACTTGGAAGG - Intergenic
1164119153 19:22250058-22250080 TGTAACCCCAAATACTAGGGAGG + Intergenic
1164249151 19:23461814-23461836 TGTAATCCCCCTTTTTAGCAGGG - Intergenic
1164254052 19:23511796-23511818 TGTAGTCCCAACTACTAGCGAGG + Intergenic
1164271901 19:23680179-23680201 TGTAATCCCAACTACTAGGGAGG + Intronic
1164316778 19:24096178-24096200 TGTAATCCCAACTACTTGAAAGG - Intronic
1164662765 19:29992189-29992211 TGTAATCCCCACTACTCGGGAGG - Intronic
1164860411 19:31558180-31558202 TGTAATCCCCACTACTCGGGAGG + Intergenic
1165345480 19:35246160-35246182 TGTAATCCCAAATACTCGGGAGG + Intergenic
1165457613 19:35922887-35922909 TGTAATCCCAGCTACTAGCGGGG - Intergenic
1165524500 19:36342300-36342322 TGTAATCCCAGCTACTAGGAGGG - Intronic
1165618039 19:37219375-37219397 TGTAATCCCAGCTACTAGGAAGG - Intronic
1165843370 19:38802797-38802819 TGTAATCCCAGCTACTAGGAAGG - Intronic
1166696120 19:44852269-44852291 TGTAATCCCCACTACTTGGGAGG - Intronic
1166710253 19:44932282-44932304 TGTAATCCCAGATACTAGGGAGG - Intergenic
1166972028 19:46575375-46575397 TGTAACCCCCACTACTTGGAAGG + Intronic
1167097989 19:47385553-47385575 TGTAATCCCACATACTCGGAAGG - Intergenic
1167189362 19:47973674-47973696 TGTAATACCCAATAATATCCAGG - Intronic
1167255486 19:48425361-48425383 TGTAATCCCAAATACTCGGGAGG - Intronic
1167273464 19:48520062-48520084 TGTAATCCCAACTACTAGGGAGG + Intergenic
1167413451 19:49358291-49358313 TGTAATCCCAGATACTTGGAAGG + Intronic
1167674444 19:50875675-50875697 TGTAATCCCAATTACTAGGGAGG + Intronic
1167898888 19:52603424-52603446 TGAAATCCCAGATACTAGAAAGG + Intronic
1167900498 19:52618211-52618233 TGTAATCCCAGGTACTAGAAAGG - Intronic
1167912470 19:52715331-52715353 TGTAATCCCCAATACTGGGGAGG + Intronic
1167920064 19:52775882-52775904 TGTAATCCCCAATACTCGGGAGG + Intronic
1168052482 19:53839737-53839759 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1168074270 19:53970808-53970830 TGTAGTCCCCACTACTAGGGAGG + Intronic
1168428770 19:56260334-56260356 TGTAATCCCAGCTACTAGGAAGG - Intronic
1202640145 1_KI270706v1_random:75477-75499 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1202660572 1_KI270708v1_random:66063-66085 TGTAATCCCAAATACTTGGGAGG - Intergenic
925660792 2:6200091-6200113 TGTAATCCCCACTACTTGGGAGG - Intergenic
926189092 2:10714057-10714079 TGTAATCCCAGCTACTAGCAAGG - Intergenic
926253618 2:11170708-11170730 TGTAATCCCAGCTACTAGGAAGG - Intronic
927312278 2:21644728-21644750 TGTAATCCCAAATACTCAGAAGG - Intergenic
927753776 2:25692569-25692591 TGTAATCCCAGCTACTTGCAAGG - Intergenic
927985507 2:27407923-27407945 TGTAATCCCAACTACTAGGGAGG + Intronic
928080134 2:28304175-28304197 TGTAATCCCAGCTACTAGGAAGG - Intronic
928168175 2:28985989-28986011 TGTAATCCCAGCTACTTGCAAGG + Intronic
928440326 2:31286790-31286812 TGTAATCCCAAGTACTAGGGAGG - Intergenic
928521645 2:32094845-32094867 TGTAATCCCAAATACTCGGGAGG + Intronic
928727337 2:34190258-34190280 TGTAATCTCCAAAAGTGGCAAGG - Intergenic
928969914 2:37017261-37017283 TGTAATCCCAGATACTTGGAAGG + Intronic
929005829 2:37392006-37392028 TGTAATCCCAACTACTAGGGAGG - Intergenic
929192677 2:39154111-39154133 TGTAATCCCAAATACTTGGGAGG + Intergenic
929280308 2:40071125-40071147 TGTAATCCCAGCTACTAGGAAGG + Intergenic
929281162 2:40080861-40080883 TGTAATCCCAGCTACTAGGAAGG + Intergenic
929345998 2:40885564-40885586 TGTTATCCGCAATACTAGCAAGG + Intergenic
929507213 2:42537441-42537463 TGTAATCCCCACTACTCGGGAGG + Intronic
929507689 2:42541151-42541173 TGTAATCCCAGCTACTAGAAAGG - Intronic
929648835 2:43657272-43657294 TGTAATCCCAACTACTAGGAGGG - Intronic
929686695 2:44041293-44041315 TGTAATCCCCACTACTTGGGAGG - Intergenic
930075437 2:47402269-47402291 TGTGATCCCAGATATTAGCAGGG - Intergenic
930195378 2:48504517-48504539 TGTAATCCCCACTACTCGGGAGG + Intronic
930447613 2:51494979-51495001 TGAAATGCCTAATATTAGCAGGG + Intergenic
930634036 2:53785716-53785738 TGTAATCCCAACTACTCGGAAGG + Intronic
930782210 2:55233748-55233770 TGTAATCCCCACTAATAGGGAGG - Intronic
931063976 2:58563454-58563476 TGTAATCCCCACTACTTGGGAGG + Intergenic
931137376 2:59418252-59418274 TGTAATCCCCACTACTTGGGAGG - Intergenic
931367068 2:61628295-61628317 TGTAATCCCCACTACTCGGGAGG + Intergenic
931426315 2:62175118-62175140 TGTAATCCCAACTACTAGGGAGG + Intergenic
931431019 2:62209101-62209123 TGTAATCCCAGCTACTAGGAAGG - Intronic
931574938 2:63709109-63709131 TGTAATCCCAGATACTAGGTAGG + Intronic
931574954 2:63709191-63709213 TGTAATCCCAGATACTAGGTAGG + Intronic
931741683 2:65251481-65251503 TGTAATCCCAAATACTTGGGAGG - Intronic
931945251 2:67299327-67299349 TGTAGTCCTCAATACTTGGAGGG - Intergenic
932100938 2:68898474-68898496 TGTAATCACCAATGCTGGAAGGG - Intergenic
932810323 2:74820267-74820289 TGTAATCCCAACTACTCGGAAGG - Intergenic
933680524 2:85095806-85095828 TGTAATCCCAACTACTAGGGAGG - Intergenic
933756074 2:85639574-85639596 TGTAATCCCAGCTACTAGGAAGG - Intronic
934508693 2:94918227-94918249 TGTAATCCCAGATACTAGTGAGG + Intergenic
934743437 2:96742448-96742470 TGTAATCCCAGATACTTGGAAGG + Intergenic
935167749 2:100584162-100584184 TGTAATCCCAGCTACTTGCAAGG + Intergenic
935986900 2:108682376-108682398 TGTAATCCCAGATACTCGCGAGG + Intronic
936132945 2:109862671-109862693 TGTAATCCCAACTACTAGGGAGG + Intergenic
936211752 2:110508814-110508836 TGTAATCCCAACTACTAGGGAGG - Intergenic
936378374 2:111962383-111962405 TGTAATCCCAACTACTTGGAAGG + Intronic
936420891 2:112363393-112363415 TGTAATCCCAACTACTAGGGAGG - Intergenic
936746796 2:115586202-115586224 TGTAATCCCAACTACTAGGAGGG + Intronic
937270429 2:120647771-120647793 TGTAATCTTCAAAACTATCAAGG - Intergenic
937687421 2:124713497-124713519 TGTAATCCCAACTACTAGGGAGG - Intronic
937720590 2:125090593-125090615 TGTAATCCCCACTACTACAGAGG + Intergenic
938044411 2:128104766-128104788 TGTAATCCCAGCTACTTGCAAGG - Intronic
938509325 2:131924373-131924395 TGTAGTCCCAGCTACTAGCAAGG - Intergenic
939699850 2:145376858-145376880 TGTAATCCCAGATACTCGGAAGG + Intergenic
940256839 2:151740007-151740029 TGTACTCCTCAAAACTAACAAGG - Intergenic
940294639 2:152109877-152109899 TGTAATCCCAGCTACTTGCAGGG - Intergenic
940650928 2:156439723-156439745 TGTAATCCCAGCTACTAGGAAGG + Intronic
940845926 2:158642141-158642163 TGTAATCCCAACTACTTGGAAGG - Intronic
940920732 2:159303490-159303512 TGTAATCCCCACTACTCGGGAGG - Intergenic
941094343 2:161218880-161218902 TGTAATCCCAACTACTAGGGAGG - Intronic
941524871 2:166594809-166594831 TGTAATCCCAAATAGTTGGAAGG + Intergenic
941777130 2:169405473-169405495 TGTAATCCCAACTACTAGGGAGG - Intergenic
941816788 2:169803858-169803880 TGTAATCCCAACTACTCGGATGG - Intronic
941898625 2:170656085-170656107 TGTAATCCCAGCTACTAGGAAGG + Intergenic
941981199 2:171459184-171459206 TGTAATCCCACCTACTCGCAAGG + Intronic
942100858 2:172582032-172582054 TGTAATCCCCACTACTCGGGAGG - Intronic
942662005 2:178275388-178275410 TGTAATCCCAACTACTCACAAGG + Intronic
942670861 2:178375542-178375564 TGTAATCCCCACTACTTGGGAGG - Intronic
943033495 2:182713507-182713529 TGTAATCCCCACTACTTGGGAGG + Intergenic
943043735 2:182833114-182833136 TGTAATCCCCACTACTTGGGAGG - Intergenic
943066269 2:183089893-183089915 TGTAATCCCAGCTACTAGGAAGG - Intronic
943171368 2:184405259-184405281 TGTAATCCCAACTACTAGGCAGG + Intergenic
943436512 2:187870591-187870613 TGTAATCCCAGTTACTAGCGGGG - Intergenic
943520848 2:188947287-188947309 TGTAATCCCAGCTACTAGGAAGG - Intergenic
943590112 2:189786001-189786023 TGTAATCCCAGCTACTTGCAGGG + Intronic
943603122 2:189944178-189944200 TGTAATCCCCAATGCTGGAGCGG + Intronic
944224133 2:197332951-197332973 TATAATCCCAAATGCAAGCAAGG - Intergenic
944304207 2:198160033-198160055 TGTAATCCCCACTACTCAGAAGG - Intronic
944717849 2:202392868-202392890 TGTAATCCCAACTACTTGGAAGG + Intronic
944834886 2:203569604-203569626 TGTAATCCCAACTACTAGCAGGG - Intergenic
944913391 2:204332514-204332536 TGTAGTCCCAAATACTAGGGAGG - Intergenic
944959511 2:204855167-204855189 TGTAATCCCAAATACTTGGGAGG - Intronic
944978544 2:205087744-205087766 TGAAATGCCTAATACTAACACGG - Intronic
945541827 2:211097532-211097554 TGTAATCCCAGATACTAGGGAGG - Intergenic
945751956 2:213798373-213798395 TGTAATCCCAGCTACTAGCGAGG - Intronic
945803194 2:214460027-214460049 TGTAATCCCAACTACTCGCGAGG - Intronic
946853369 2:223929307-223929329 TGTAATCCCAGCTACTAGCGGGG - Intronic
946915933 2:224521550-224521572 TGTAATCCCAGCTACTAGCGGGG - Intronic
947437082 2:230082082-230082104 TGTAATCCCCACTACTCGGGAGG - Intergenic
947456552 2:230259562-230259584 TGTAATCCCAGCTACTAGCAGGG + Intronic
947975764 2:234364458-234364480 TGTAATCCCAGCTACTCGCAAGG + Intergenic
948105674 2:235411872-235411894 TGTAATCCCCAATGCTGGAGGGG + Intergenic
948628860 2:239288629-239288651 TGCAATTCCAAAAACTAGCAAGG + Intronic
948655596 2:239475179-239475201 TGTTCTCCCCAGAACTAGCAGGG - Intergenic
948929625 2:241123694-241123716 TGTAATCCCCACTACTCGGGAGG + Intronic
1168775923 20:447534-447556 TGTAATCCCAGCTACTAGGAAGG + Intronic
1168914923 20:1477795-1477817 TGTAATCCCAGATACTTGGAAGG - Intronic
1169395378 20:5224456-5224478 TGTAATCCCAGCTACTCGCAAGG - Intergenic
1169435896 20:5589488-5589510 TGTAATCCCAACTACTCGGAAGG + Intronic
1169464253 20:5823567-5823589 TGTAATCCCAGCTACTAGGAAGG - Intronic
1169546838 20:6659152-6659174 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1169890919 20:10451280-10451302 TGTAATCCCAGCTACTCGCAAGG - Intronic
1169891322 20:10455729-10455751 TGTAATCCCAACTACTGGGAAGG - Intronic
1169902192 20:10564866-10564888 GGTAATACCCAATATTGGCAAGG - Intronic
1170653703 20:18266529-18266551 TGTAATCCCAAATACTCGGGAGG - Intergenic
1170986063 20:21260106-21260128 TGTAATCCCAGCTACTAGCAAGG - Intergenic
1171070959 20:22068127-22068149 TGTAATCCCCACTACTTGGGAGG - Intergenic
1171352056 20:24510445-24510467 TGTAATCCCAACTACTAGGGAGG + Intronic
1171887034 20:30662134-30662156 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1171981062 20:31629473-31629495 TGTAATCCCAAATACTTGGGAGG + Intergenic
1172166792 20:32904420-32904442 TGCAGTCCCAAATACTTGCAAGG - Intronic
1172363453 20:34331166-34331188 TGTAATCCCAACTACTTGAAAGG + Intergenic
1172440478 20:34962103-34962125 TGTCATCCCCACTACTAGGGAGG + Intergenic
1172453360 20:35045658-35045680 TGTAATCCCCACTACTTGGGAGG - Intronic
1172459514 20:35106321-35106343 TGTAATCCCAACTACTAGGAAGG + Intergenic
1172466057 20:35155353-35155375 TGAAATACCCAATTCTGGCAGGG + Intergenic
1172469374 20:35180122-35180144 TGTAATCCCAGCTACTAGCAGGG + Intergenic
1172986900 20:38998916-38998938 TGTAATCCCAGCTACTAGGAAGG - Intronic
1173050718 20:39558522-39558544 TGTAATCCCCGCTACTTGGAAGG + Intergenic
1174178689 20:48661295-48661317 TGTAATCCCAGCTACTCGCAAGG + Intronic
1174524803 20:51162376-51162398 TTTAAGCCCCAATACTAATATGG - Intergenic
1174593644 20:51666557-51666579 TGTAATCCCAGCTACTAGGAAGG + Intronic
1174631379 20:51960957-51960979 TGTAATCCCAGATACTAGGGAGG - Intergenic
1175276879 20:57777550-57777572 TGTAATCCCAGCTACTAGCGGGG - Intergenic
1175313220 20:58026041-58026063 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1175506276 20:59486827-59486849 TGTAATCCACTATACTAATAAGG + Intergenic
1175520895 20:59602307-59602329 TGTACTCCCAAGTACTAGGAAGG + Intronic
1176648472 21:9373063-9373085 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1176784160 21:13234187-13234209 TGTAGTCCCAGCTACTAGCAAGG + Intergenic
1176851035 21:13914298-13914320 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1177236887 21:18402405-18402427 TGTAGTCCCAGCTACTAGCAAGG + Intronic
1177430767 21:20989598-20989620 TGTAGTCCCAAATACTTGGAAGG + Intergenic
1177542391 21:22511480-22511502 TGTAATCCCAAATACTTGGGAGG + Intergenic
1177982200 21:27928021-27928043 TGTAGTCCCAGCTACTAGCAAGG + Intergenic
1179554852 21:42165939-42165961 TGTAATCCCCACTACTCGAGAGG + Intergenic
1179875576 21:44265709-44265731 TGTAATCCCAGATACTAGGGAGG - Intergenic
1180328054 22:11449653-11449675 TGTAATCCCAAATACTTGGGAGG - Intergenic
1180361795 22:11906422-11906444 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1180642110 22:17307292-17307314 TGTAATCCCAGCTACTAGCGAGG + Intergenic
1181008113 22:20024063-20024085 TGTAATCCCAACTACTCGAAAGG + Intronic
1181598700 22:23936303-23936325 TTTCCTCCCCAATAATAGCATGG - Intergenic
1181958656 22:26607142-26607164 TGTAATCCCAGCTACTAGCAAGG - Intronic
1182218267 22:28737589-28737611 TGTAATCCCAACTACTTGGAAGG - Intronic
1182309718 22:29395849-29395871 TGTAATCCCAACTACTAGGGGGG + Intronic
1182462704 22:30493880-30493902 TGTAATCCCAGCTACTAGGAAGG + Intronic
1182638326 22:31747230-31747252 TGTAATCCCAGCTACTAGGAAGG - Intronic
1182652587 22:31864228-31864250 TGTAATCCCAACTACTAGGGAGG - Intronic
1182673192 22:32015289-32015311 TGTAATCCCAACTACTTGGAAGG + Intergenic
1182833396 22:33321938-33321960 TGTAATCCCAGCTACTAGGAAGG - Intronic
1183115385 22:35687994-35688016 TGTAATCCCAAATACTTGGGAGG + Intergenic
1183221041 22:36513422-36513444 TGTAATCCCAACTACTAGGGAGG - Intronic
1183514746 22:38258420-38258442 TGTAATCCCAGCTACTAGGAAGG - Intronic
1183658199 22:39203021-39203043 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1183887844 22:40899912-40899934 TGTAATCCCGAATACTCGGGAGG + Intronic
1184118527 22:42435939-42435961 TGTAATCCCAACTACTCGGAAGG - Intergenic
1184563905 22:45279761-45279783 TGTAATCCCAGCTACTAGAAAGG + Intergenic
1184575707 22:45363968-45363990 TGTAATCCCAGCTACTAGGAAGG - Intronic
1184628077 22:45753525-45753547 TGTAATCCCAGCTACTAGGAAGG - Intronic
1184882401 22:47317337-47317359 TGTAATCCCAACTACTAGGGAGG - Intergenic
1184985261 22:48128241-48128263 TGTAATCCCAAATACTTGGGAGG + Intergenic
1185257686 22:49845088-49845110 TGCAATCCCAGCTACTAGCAAGG - Intergenic
1185268272 22:49916457-49916479 TGTAATCCCAACTACTTGGAAGG + Intronic
1185379414 22:50501058-50501080 TGTAATCCCAGCTACTTGCAAGG + Intergenic
949259338 3:2086709-2086731 TGTAATCCCAGCTACTCGCAAGG + Intergenic
949576691 3:5345406-5345428 TGTAATCCCAACTACTAGGGAGG + Intergenic
950364045 3:12470596-12470618 TGTAATCCCAGCTACTAGGAAGG + Intergenic
950372106 3:12539905-12539927 TGTAATCCCAACTACTAGGGAGG - Intronic
950591418 3:13938260-13938282 TGTAATCCCCACTACTTGGGAGG - Intronic
951005222 3:17608133-17608155 TGTAATCCCAGATACTAGGGGGG + Intronic
951337348 3:21440410-21440432 AGTACTCCTCAAAACTAGCAAGG + Intronic
951417608 3:22444101-22444123 TGTAATCCAAAATGTTAGCAAGG - Intergenic
951538348 3:23759946-23759968 TGTAATCCCAGATACTAGGGAGG + Intergenic
951854479 3:27179957-27179979 TGTAATCCCAGGTACTCGCAAGG + Intronic
951876979 3:27438073-27438095 TGTAATCCCAAATACTCGGGAGG + Intronic
951967955 3:28409239-28409261 TGTAATCCCAGCTACTTGCAAGG - Intronic
952061611 3:29517442-29517464 TGTAGTCCTGAATACTAGGAAGG - Intronic
952164548 3:30732933-30732955 TGTAATCCCAACTACTAGGGAGG + Intronic
952233811 3:31458457-31458479 TGTAATCCCAGATACTGGCTGGG + Intergenic
952299363 3:32090243-32090265 TGTAATCCCAGCTACTAGCGAGG + Intergenic
952421671 3:33137259-33137281 TGTAATCCCAGCTACTAGGATGG - Intronic
952625542 3:35398533-35398555 TGTAGTCCCCACTACTTGGAGGG + Intergenic
952990972 3:38830462-38830484 TGTAATCCCAGATACTAGGGAGG - Intergenic
953600279 3:44356403-44356425 TGTAATCCCAGCTACTTGCAAGG + Intronic
953615631 3:44488311-44488333 TGTAATCCCAATTACTAGGGAGG + Intergenic
953681377 3:45041091-45041113 TGTAATCCCCACTACTAGGGAGG - Intergenic
953953104 3:47207925-47207947 TGTAATCCCAGCTACCAGCAGGG - Intergenic
953958633 3:47249925-47249947 TGTAATCCCAACTACTAGAGAGG + Intronic
953962375 3:47276432-47276454 TGTAATCCCAGCTACTAGCAGGG + Intronic
953992922 3:47497808-47497830 TATAATCCCAAGTACTAGGAAGG + Intronic
954018760 3:47719578-47719600 TGTAATCCCAGCTACTAGGAAGG + Intronic
954335545 3:49914667-49914689 TGTAATCCCAGCTACTTGCAAGG - Intronic
954569203 3:51626386-51626408 TGTAACATCCAATACCAGCAAGG - Intronic
954724965 3:52600758-52600780 TGTAATCCCAACTACTCGGAAGG - Intronic
954844189 3:53540861-53540883 TGTAATCCCAAATACTTGGGAGG - Intronic
955275711 3:57545263-57545285 TGTAATCCCAACTACTTGGAAGG - Intergenic
955293909 3:57718049-57718071 TGTAATCCCAACTACTAGGGAGG - Intergenic
957517423 3:81273893-81273915 TGTAATCCCAGATACTAGGGAGG + Intergenic
957626836 3:82663978-82664000 TGTAATCCCAGCTACTTGCAAGG - Intergenic
957721462 3:84006283-84006305 TGTAATCCAGAATAATAGCAAGG + Intergenic
957906308 3:86560636-86560658 TGTAATCCCCAATGTTGGCCTGG - Intergenic
957926772 3:86824185-86824207 TGTAATCCCAGCTACTAGCGAGG + Intergenic
958262919 3:91403781-91403803 AGAAACCCCCAGTACTAGCATGG - Intergenic
958458474 3:94363906-94363928 TGTAATCCCAGCTACTAGGAAGG - Intergenic
958581620 3:96032932-96032954 TGTAATCCCAGCTACTAGGAAGG - Intergenic
958680155 3:97319546-97319568 TGTAATCCCAACTACTTGGAAGG + Intronic
958973621 3:100640641-100640663 TGTAATCCCAACTACTAGGGAGG - Intronic
959014991 3:101123650-101123672 TGTAATCCCAAATACTCGGGAGG - Intergenic
959080854 3:101799545-101799567 TGTAATCCCAACTACTCGGAAGG - Intronic
959167479 3:102798667-102798689 TGTGATCCTAAATACTAGGAGGG - Intergenic
959713103 3:109404324-109404346 TGTAATCCCAATTATTCGCAAGG - Intergenic
959967018 3:112367660-112367682 TGTAATCCCGACTACTCGGAAGG - Intergenic
960080780 3:113537902-113537924 TGTAATCCCAGCTACTAGCAAGG - Intronic
960588411 3:119342825-119342847 TGTAATCCCCACTACTCGGGAGG + Intronic
960905426 3:122596232-122596254 TGTAATCCCAGCTACTAGGAAGG + Intronic
961248461 3:125478199-125478221 TGTAATCCCCACTACTCGGGAGG - Intronic
961408401 3:126699803-126699825 TGTAATCCCAATTACTTGGAAGG - Intergenic
961549290 3:127659697-127659719 TGTAATTCCCAAGAATGGCAGGG + Intronic
961654014 3:128431764-128431786 TGTGACCCCCAAACCTAGCATGG - Intergenic
961841157 3:129713592-129713614 TGTAATCCCAGATACTTGGAAGG + Intronic
962038144 3:131676178-131676200 TGTAATCCCAGCTACTAGGAAGG - Intronic
962333257 3:134499943-134499965 TGTAATCCCAGCTACTTGCAAGG - Intronic
962651664 3:137499949-137499971 TGTAATCCCAACTACTTGAAGGG - Intergenic
962748009 3:138411898-138411920 TGTAATCCCAACTACTAGGGAGG + Intergenic
962816321 3:139004599-139004621 TGTAATCCCAGCTACTAGCAGGG - Intergenic
962881569 3:139582071-139582093 TGTAATCCCAGCTGCTAGCAAGG + Intronic
963169603 3:142237477-142237499 TGTAATCCCCACTACTTGGGAGG + Intergenic
963394766 3:144717304-144717326 TGTAATCCCAGCTACTAGGAAGG + Intergenic
963801327 3:149678949-149678971 TGTAATCCCAGATACTAGGGAGG - Intronic
963817632 3:149850099-149850121 TGTAATCCCAGCTACTTGCAAGG - Intronic
963902548 3:150746272-150746294 TGTAATCCCAGCTACTAGGAAGG + Intronic
964183469 3:153914611-153914633 TGGATTCTCCAATACCAGCAGGG + Intergenic
964346012 3:155755656-155755678 TGTAATCCCAGTTACTTGCAAGG - Intergenic
964632139 3:158822847-158822869 GACAATGCCCAATACTAGCAAGG - Intronic
964644820 3:158947651-158947673 TGTGATCCCGAATACTAGATAGG - Intergenic
965238115 3:166155496-166155518 TGTAATCCCAGCTACTAGGAAGG + Intergenic
966017485 3:175159956-175159978 TGTAATCCCAGCTACTAGGAAGG - Intronic
966142145 3:176768757-176768779 TGTAATCCCAACTACTAGGGAGG + Intergenic
966185459 3:177222963-177222985 TGTAATCCCCACTACTTGGGAGG - Intergenic
966223474 3:177573255-177573277 TGTAATCCCAACTACTAGGGAGG - Intergenic
966299019 3:178458097-178458119 GGTAATCTCCAATACTGACAGGG - Intronic
966399163 3:179530431-179530453 TGTAGTCCCAAATACTTGGAAGG + Intergenic
966503315 3:180671088-180671110 TGTAATCCCACCTACTTGCAGGG + Intronic
966788608 3:183643106-183643128 TGTAATCCCAACTACTAGGGAGG + Intronic
966928646 3:184661665-184661687 TGTAATCCCAGCTACTAGGAAGG - Intronic
966987451 3:185194488-185194510 TGTAATCCCCACTACTTGGGAGG + Intronic
967024995 3:185556914-185556936 TGTAATCCCAACTACTCGGAAGG + Intergenic
967027471 3:185577366-185577388 TGTAATCCCAGATACTAGGGAGG + Intergenic
967337816 3:188363781-188363803 TGTAATCCCAACTACTAGGGAGG + Intronic
967806704 3:193720707-193720729 TGTAATCCCCACTACTCGGGAGG - Intergenic
968027561 3:195455425-195455447 TGTAATCCCAGATACTTGCGAGG - Intergenic
968191209 3:196668797-196668819 TGTAGTCCCAACTACTAGGAAGG + Intronic
968237949 3:197048775-197048797 TGTAATCCCAACTACTTGGAAGG - Intronic
968322903 3:197787230-197787252 TGTAATCCCAGATACTTGGAAGG - Exonic
1202738410 3_GL000221v1_random:31922-31944 TGTAATCCCAGCTACTAGGAAGG + Intergenic
968820564 4:2847297-2847319 TGTAATCCCCACTACTAGGGAGG + Intronic
969329464 4:6465096-6465118 TGTAATCCCAAGTCCCAGCAAGG - Intronic
969341187 4:6542579-6542601 TGTAATCCCAGATACTAGGGAGG + Intronic
969614344 4:8243643-8243665 TGTAATCCCAGCTACTAGAAAGG - Intergenic
969617012 4:8259470-8259492 TGTAATCCCCACTACTCGAGAGG - Intergenic
969792362 4:9500672-9500694 TGTAATCCCCACTACTCGGGAGG - Intergenic
970435527 4:16030922-16030944 TGTAATCCCAGCTACTAGGAAGG + Intronic
970891209 4:21046711-21046733 TGTAATCCCAGCTACTTGCAGGG - Intronic
970954665 4:21795945-21795967 TGTAATCCCAGCTACTAGGAAGG + Intronic
971012425 4:22453078-22453100 TGTAATCCCAGCTACTCGCAAGG + Intronic
971015439 4:22484481-22484503 TGTAATCCCAGCTACTAGGAAGG + Intronic
971197535 4:24483683-24483705 TGTAATCCCAACTACTAGGGAGG + Intergenic
971569827 4:28197037-28197059 TGTAATCCCAACTACTAGGGAGG + Intergenic
971920600 4:32934327-32934349 TGTAATCCCCACTACTCGGGAGG - Intergenic
972191212 4:36593473-36593495 AGTACTCCCCAAAACTATCAAGG + Intergenic
972518671 4:39833067-39833089 TGTAATCCCAGATACTAGGGAGG + Intronic
972590062 4:40477059-40477081 TGTAATCCCAACTACTCGGAAGG + Intronic
972639135 4:40910074-40910096 TGTAATCCCCGCTACTAGGGAGG - Intronic
972677757 4:41276673-41276695 TGTAGTCCCAGCTACTAGCAGGG - Intergenic
972852419 4:43067656-43067678 TGTAATCCCAGCTACTAGGAAGG - Intergenic
972966606 4:44518408-44518430 TGTAATCCCAACTACTAGAGAGG - Intergenic
973370385 4:49241831-49241853 TGTAATCCCAGCTACTAGGAAGG - Intergenic
973390642 4:49553590-49553612 TGTAATCCCAGCTACTAGGAAGG + Intergenic
973733575 4:53847639-53847661 TATAATATCCAATTCTAGCAAGG + Intronic
974564038 4:63560912-63560934 TGTAATCCCAGATACTAGGGAGG - Intergenic
974580662 4:63796614-63796636 TGTAATCCCAGATACTCGGAAGG - Intergenic
974755648 4:66203463-66203485 TGTAATCCCAGCTACTCGCAAGG + Intergenic
975230083 4:71923067-71923089 TGTAATTCCCAATGTTTGCAGGG + Intergenic
976296071 4:83473639-83473661 TGTAGTCCCCATTACTAGGGAGG - Intronic
976298054 4:83491682-83491704 TGTAATCCCAACTACTAGAGTGG + Intronic
976597408 4:86906916-86906938 TGTAATCCCAACTACTAGGGAGG + Intronic
976664794 4:87578739-87578761 TGTAATCCCCACTACTCGGGAGG - Intergenic
976923836 4:90471853-90471875 TGTAATCCCAGCTACTTGCAAGG + Intronic
977611081 4:99032352-99032374 TGTAATCCCAACTACTCGGAAGG - Intronic
977970378 4:103206371-103206393 TGTAATCCCCACTACTGGGGAGG - Intergenic
978440298 4:108727338-108727360 TGTAATCCCCATTACTTGGGAGG - Intergenic
978822047 4:112978120-112978142 TGTAATCCCAACTACTTGGAAGG + Intronic
978930024 4:114298660-114298682 TGTAATCCCAGCTACTTGCAAGG - Intergenic
979229305 4:118328743-118328765 TGTAGTCCCGACTACTAGGAAGG - Intronic
979953719 4:126927788-126927810 TGTAATCCCAACTACTTGCGAGG - Intergenic
980042305 4:127953364-127953386 TGTAATCCCAACTACTTGGAAGG + Intronic
980919069 4:139064184-139064206 TGTAATCCCAGCTACTCGCAAGG + Intronic
980923628 4:139113437-139113459 TGTAATCCCAACTACTAGGGAGG + Intronic
981014038 4:139954774-139954796 TGTAATCCCAGATACTCGAAAGG - Intronic
981130989 4:141158167-141158189 TGTAATCCCAAATACTTGGGAGG + Intronic
981287947 4:143042311-143042333 TGTAATCCCAACTACTAGGGAGG + Intergenic
982007809 4:151079987-151080009 TGTAATCCCAAGTACTAGGGAGG - Intergenic
982018822 4:151183111-151183133 TGTAATCCCAGCTACTAGGAAGG - Intronic
982565795 4:156985112-156985134 TGTAATCCCAGCTACTCGCAAGG + Intergenic
982721693 4:158866695-158866717 TGTAATCCCAGCTACTAGGAAGG - Intronic
982995197 4:162335386-162335408 TGTAATCCCAGCTACTAGCAAGG - Intergenic
983053252 4:163073006-163073028 TGTAGTCCCAAATACTAGGGAGG + Intergenic
984469681 4:180152331-180152353 TGTAATCCCAACTACTCGGAAGG + Intergenic
984570852 4:181391701-181391723 TGTAATCCACAAAAATAGCCTGG - Intergenic
984638058 4:182135082-182135104 TGTAATCCCAGCTACTAGGAAGG + Intergenic
984862119 4:184250758-184250780 TGTAATCCCCACTACTCGGGAGG - Intergenic
984909065 4:184655129-184655151 TGTAATCCCAAATACTTGGGAGG - Intronic
985046930 4:185950128-185950150 TGTAATCCCAGTTACTAGAAAGG + Intronic
985096604 4:186418503-186418525 TGTAATCCCAGCTACTAGGAAGG - Intergenic
985109727 4:186536222-186536244 TGTAATCCCAACTACTTGGAAGG + Intronic
985270251 4:188187544-188187566 TGTAATCCCAGCTACTTGCATGG - Intergenic
985278282 4:188260309-188260331 TGTTATGCCTAATACTAGTATGG + Intergenic
1202767508 4_GL000008v2_random:161336-161358 TGTAATCCCAGCTACTAGGAAGG - Intergenic
985676969 5:1237118-1237140 TGTAATCCCAACTACTTGCGAGG + Intronic
986074856 5:4326014-4326036 TGTAATCCCCACTACTCGGGAGG + Intergenic
986828244 5:11545198-11545220 TGTAATCCCAGCTACTAGGAGGG + Intronic
986949705 5:13068398-13068420 TGTAATCCCCACTACTTGAAAGG + Intergenic
987052074 5:14155584-14155606 TGTAATCGTCAAAACTATCAGGG - Intronic
987647226 5:20689641-20689663 TGTAATCCCAGCCACTAGCAGGG + Intergenic
987730825 5:21770500-21770522 TGTAATCCCCACTACTCGGGAGG + Intronic
988015911 5:25559386-25559408 TGTAATCCCAGCTACTAGGAAGG + Intergenic
988312598 5:29580562-29580584 TGTAATCCCAACTACTTGGAAGG - Intergenic
988737143 5:34033747-34033769 TATAATCACCAATACTAGGAGGG + Intronic
988867104 5:35347517-35347539 TGGAATCCTCTATACTAGTAAGG + Intergenic
989051189 5:37321975-37321997 TGTAATCCCAGCTACTAGCTAGG - Intronic
989057247 5:37377581-37377603 TGTAATCCCAGCTACTCGCAAGG + Intergenic
989387652 5:40869263-40869285 TGTAATCCCCACTACTTGGGAGG - Intergenic
989958750 5:50386117-50386139 TGTAATCCCCGCTACTAGGGAGG + Intergenic
990378183 5:55193996-55194018 TGTAATCCCAGCTACTAGGAAGG + Intergenic
990386242 5:55266118-55266140 TGTAATCCCAAATACTCGGGAGG - Intronic
990403259 5:55462083-55462105 TGGAAGACCCAATACTAACATGG + Intronic
990661802 5:58023822-58023844 TGTAATCCCAGATACTAGGGAGG - Intergenic
991067166 5:62435905-62435927 TGTAATCCCAAATACTGGGGAGG + Intronic
991338560 5:65579035-65579057 TGTAATCCCAACTACTAGGGAGG - Intronic
991347173 5:65681851-65681873 TGTAATCCCAGCTACTAGGAAGG + Intronic
991449203 5:66733577-66733599 TGTAATCCCCACTACTTGGAAGG - Intronic
991665772 5:68998602-68998624 TGTAATCCCCCCTACTAGGAAGG - Intergenic
991724233 5:69520078-69520100 TGTAATCCCAGATACTCGGAAGG - Intronic
992352336 5:75942906-75942928 TGTAATCCCAACTACTAGGGAGG + Intergenic
993083548 5:83333889-83333911 TGTAATCCCCGATACTTGGAAGG - Intronic
993702178 5:91131570-91131592 TGTAATCCCAGCTACTGGCAAGG - Intronic
993807225 5:92425782-92425804 TGTAATCCCCAATACTCAGCCGG + Intergenic
993961120 5:94297715-94297737 TGTAATCCCAATTACTCACAAGG - Intronic
994361357 5:98852127-98852149 TGTAATCCCCACTACTCGGGAGG - Intergenic
994557562 5:101323125-101323147 TGTAATCCCAGCTACTAGGAAGG + Intergenic
995087565 5:108132096-108132118 TGTAATCCCAGATACTAGGGAGG - Intronic
995433850 5:112113286-112113308 TGTAATCCCAGATACTCGGAAGG + Intergenic
996378239 5:122838034-122838056 TGTAATCCCAACTACTAGGGAGG + Intergenic
996491264 5:124100511-124100533 TGTAATCCCCACTACTGGGGAGG + Intergenic
996681976 5:126237782-126237804 GGTAATCCACAATAATAGTAAGG + Intergenic
996698815 5:126428109-126428131 TGTAATCCCAACTACTAGGGAGG + Intronic
996801172 5:127404835-127404857 TGTAATCCCAACTACTAGGGAGG - Intronic
996947057 5:129083104-129083126 TGTAATCCCAACTACTTGGAAGG + Intergenic
997101138 5:130970576-130970598 TGTAATCCCCACTACTTGGGAGG + Intergenic
997172922 5:131742340-131742362 TGTAATCCCAGCTACTCGCAAGG + Intronic
997495360 5:134319207-134319229 TGTAATCCCAACTACTCGGAAGG + Intronic
997545352 5:134701630-134701652 TGTAATCCCAGCTACTAGGAAGG - Intronic
997794663 5:136796592-136796614 TGTAATCCCAACTACTAGCAGGG + Intergenic
997966167 5:138358117-138358139 TGTAATCCCAACTACTTGCGAGG - Intronic
997972656 5:138416465-138416487 TGTAATCCCAACTACTAGGGAGG + Intronic
998020363 5:138764993-138765015 TGTAATCCCAGATACTCGGAAGG - Intronic
998432688 5:142080006-142080028 TGTAATCCCAGCTACTAGGAAGG + Intergenic
998819068 5:146042004-146042026 GGTATTCCCCAAAACTAACAAGG - Intronic
998840730 5:146250896-146250918 TGTAATCCCAACTACTAGGGAGG - Intronic
999084677 5:148876992-148877014 TGTAATCCCAGATACTAGGGAGG + Intergenic
999766320 5:154743739-154743761 TGTAATCCCAACTACTTGAAAGG - Intronic
999833706 5:155346271-155346293 TGTAATCCCCAACAGTGTCAAGG - Intergenic
999869489 5:155734324-155734346 TGTAATCCCAGATACTCGGAAGG - Intergenic
999987535 5:157017992-157018014 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1000047595 5:157534344-157534366 TGTAATCCCAGATACTCGGAAGG + Intronic
1000092991 5:157946457-157946479 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1000094148 5:157956152-157956174 TGTAATCCCAGATAGTAGGAAGG - Intergenic
1000326684 5:160177682-160177704 TGTAATCCCCGCTACTAGGGAGG - Intergenic
1000343983 5:160299098-160299120 TGTAATCCCAACTACTTGGAAGG - Intronic
1001446905 5:171792409-171792431 TGTAATCCCAATTACTAGGGAGG + Intronic
1001498856 5:172212784-172212806 TGTAATCCCAACTACTCGGAAGG - Intronic
1001833230 5:174807240-174807262 TGTAATCCCAACTACTAGGACGG - Intergenic
1002060637 5:176623746-176623768 TGTAATCCCAGATACTTGGAGGG + Intronic
1002379614 5:178817121-178817143 TGTAATCCCACCTACTAGGAAGG + Intergenic
1002397876 5:178972053-178972075 TGTAATCCCAACTACTAGGGAGG - Intergenic
1002511274 5:179719941-179719963 TGTAATCCCAGCTACTCGCAAGG - Intronic
1002707978 5:181175770-181175792 TGTAATCCCCACTACTTGGGAGG + Intergenic
1002942007 6:1725553-1725575 TGTAATCCCCACTACTCGGGAGG - Intronic
1003022707 6:2525253-2525275 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1003286456 6:4738253-4738275 TGTAATCCCAACTACTAGGGAGG + Intronic
1003353519 6:5343331-5343353 TGTAATCCCAGCTACTAGGAAGG - Intronic
1003359987 6:5415826-5415848 TGTAATCCCCATTACTTGGGAGG - Intronic
1003706491 6:8537120-8537142 TGTAGTCCCAAATACTTGGAAGG - Intergenic
1003777560 6:9385912-9385934 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1003994413 6:11524297-11524319 TGTAATCCCAACCACTAGGAAGG + Intergenic
1004117021 6:12779211-12779233 TGTAATCCCAGCTACTTGCAAGG + Intronic
1004184331 6:13408961-13408983 TGTAATCCCAAGTACTTGCAAGG + Intronic
1004195389 6:13499714-13499736 TGTAATCCCAACTACTAGGGAGG - Intergenic
1004195685 6:13502352-13502374 TGTAATCCCAACTACTTGGAAGG + Intergenic
1004614383 6:17276084-17276106 TGTAATCCCTACTACTAGGGAGG + Intergenic
1004659061 6:17693762-17693784 TGTAATCCCAGCTACTAGGAAGG + Intronic
1004694098 6:18018109-18018131 TCTAATCCCAACTACTAGGAAGG - Intergenic
1004704755 6:18114108-18114130 TGTAATCCCAGATACTAGGGAGG + Intergenic
1004899361 6:20180203-20180225 TGTCATCTCCATTACTAGCCTGG + Intronic
1004941033 6:20556241-20556263 TGTAATCCCAGCTACTAGGAAGG + Intronic
1004951437 6:20677190-20677212 TGTAATCCCAACTACTAGGGAGG - Intronic
1005071408 6:21865759-21865781 TGTAATCCCCGCTACTAGGGAGG + Intergenic
1005409667 6:25530391-25530413 TGTAATCCCAACTACTTGGAAGG + Intronic
1005991265 6:30903963-30903985 TGTAATCCCAACTACTCGGAAGG + Intergenic
1006086002 6:31595664-31595686 TGTAATCCCAGATACTAGGGAGG - Intergenic
1006177385 6:32130575-32130597 TGTAATCCCAACTACTCGGAAGG + Intergenic
1006497522 6:34434621-34434643 TGTAATCCCAGATACTCGGAAGG - Intergenic
1006868741 6:37231179-37231201 TGTAATCCCAGCTACTTGCAAGG - Intronic
1006937188 6:37726693-37726715 TGTGATCCCAGCTACTAGCAAGG + Intergenic
1006944209 6:37773790-37773812 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1007106513 6:39286947-39286969 TGTAATCCCAACTACTAGGGAGG - Intergenic
1007140052 6:39563117-39563139 TGTAGTCCCAGATACTAGGAAGG + Intronic
1007361837 6:41363122-41363144 TGTAATCCACTATATTAACAGGG + Intergenic
1008350537 6:50484500-50484522 TGTAGTCCACCATACTAACAGGG + Intergenic
1009181110 6:60518218-60518240 AGAAACCCCCAGTACTAGCATGG + Intergenic
1009654990 6:66532496-66532518 TGTAATCCCCGTTACTAGGGAGG + Intergenic
1010793214 6:80089216-80089238 TGTAATCCCAACTACTCGGAAGG - Intergenic
1011267489 6:85537825-85537847 TGTAATCCCAGCTACTAGGAAGG + Intronic
1011324584 6:86135802-86135824 TGTAATCCCAGCTACTAGTAGGG - Intergenic
1011389212 6:86833368-86833390 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1012559320 6:100559722-100559744 TGTAATCCCAAATACTTGGGAGG + Intronic
1012588928 6:100955288-100955310 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1012900458 6:104999448-104999470 GATAATACCTAATACTAGCAAGG + Intronic
1013109077 6:107050696-107050718 TGTGATCCCAAATACTCGGAAGG - Intronic
1013131878 6:107241125-107241147 TGTAGTCCCAACTACTTGCAAGG + Intronic
1013135820 6:107282025-107282047 TGTAATCCCAAATACTAGGGAGG - Intronic
1013359919 6:109384132-109384154 TGTAATCCCAGCTACTAGCAGGG + Intergenic
1013431749 6:110062345-110062367 TGTAATCCCAACTACTAGGGAGG - Intergenic
1013572208 6:111440189-111440211 TGTAATCCCAGCTACTAGGAGGG - Intronic
1014250807 6:119113818-119113840 TGTAATCCCAGATACTTGGAAGG + Intronic
1014687358 6:124518653-124518675 TGTAATCCCCAATGCTGGAGGGG - Intronic
1015876459 6:137827710-137827732 AGTAATCCTCAAAACTATCAAGG - Intergenic
1016174067 6:141056060-141056082 TGTAATCCCAACTACTTGGAAGG + Intergenic
1016962524 6:149687549-149687571 TGTAATCCCAACTACTTGGAAGG - Intronic
1017117787 6:150995390-150995412 TGTAATCCCAGCTACTAGGAAGG + Intronic
1017393983 6:153975243-153975265 TGCAATCCCACATGCTAGCAAGG - Intergenic
1017587565 6:155944126-155944148 TGTAATCCCAACTACTTGGAAGG - Intergenic
1017765294 6:157602366-157602388 TGTAATCCCAGCTACTAGGAAGG + Intronic
1018071190 6:160166170-160166192 TGTAGTCCCAGCTACTAGCAGGG - Intergenic
1018079188 6:160244204-160244226 TGTAATCCCAACTACTAGGGAGG - Intronic
1018303831 6:162432402-162432424 TGTAATCCCAGCTACTAGCAGGG + Intronic
1018547406 6:164952710-164952732 TGAAATCCCCACTACTTGGAAGG + Intergenic
1018648503 6:165971024-165971046 TGTAATCCCAATTACTCGGAAGG + Intronic
1019085778 6:169475342-169475364 TGTAATCCCCACTACTTGGGAGG - Intronic
1019206038 6:170362801-170362823 TGTAGTCCCAACTACTAGGAAGG - Intronic
1019964787 7:4489927-4489949 TGTAATCCCAACTACTCGGAAGG + Intergenic
1020154998 7:5715861-5715883 TGTAATCCCCACTACTCGGGAGG - Intronic
1020569810 7:9845085-9845107 TGTAATCCCAGATACTAGGGAGG + Intergenic
1020656199 7:10930680-10930702 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1021150278 7:17142360-17142382 TGTAATCCCAGATACTAGGGAGG + Intergenic
1021211001 7:17852250-17852272 TGTAATCCCAGCTACTAGGAAGG + Intronic
1021337935 7:19427210-19427232 TGTAATCCTCAAAAGTATCAAGG - Intergenic
1021533944 7:21681303-21681325 TGTAATCCCAACTACTAGGGAGG + Intronic
1021711203 7:23416932-23416954 TGTAATCCCAACTACTAGTGAGG + Intronic
1021716140 7:23464560-23464582 TGTAATCCCAGCTACTAGGAGGG + Intronic
1022116726 7:27267576-27267598 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1022191949 7:28025087-28025109 TATAATCCCCAATCCTAACCTGG + Intronic
1022666963 7:32420430-32420452 TGTAATCCCAACTACTAGTGAGG + Intergenic
1022992012 7:35717909-35717931 TGTAATCCCAACTACTTGGAAGG + Intergenic
1023007914 7:35894098-35894120 TGTGATCCCCAATAAGAGGAGGG + Intronic
1023255041 7:38304874-38304896 TGAAATCCCCAAGATCAGCAGGG - Intergenic
1023619670 7:42056858-42056880 TGTAATCCCAGCTACTTGCAAGG + Intronic
1023671348 7:42580366-42580388 TGTAATCCCCACTACTTGGAAGG - Intergenic
1024469282 7:49750409-49750431 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1024839310 7:53566602-53566624 TGTAATCCCAACTACTCGGAAGG - Intergenic
1025097475 7:56107559-56107581 TGTAATCCCAACTACTCGGAAGG - Intergenic
1025184232 7:56844659-56844681 TGTAATCCCCACTACTTGGAAGG - Intergenic
1025618716 7:63147895-63147917 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1025687697 7:63732309-63732331 TGTAATCCCCACTACTTGGGAGG + Intergenic
1025747725 7:64259031-64259053 TGTAATCCCAGATACTAGAGAGG - Intronic
1025801083 7:64786662-64786684 TGTAATCCCAACTACTTGGAAGG + Intergenic
1025934650 7:66025559-66025581 TGTAATCCCGGATACTAGGGAGG + Intergenic
1025949844 7:66135797-66135819 TGTAATCCCAACTACTAGGGAGG + Intronic
1025978204 7:66386266-66386288 TGTAATCCCAGCTACTAGGAAGG - Intronic
1026182145 7:68051019-68051041 TGTAATCCCAACTACTTGGAAGG - Intergenic
1026206544 7:68262651-68262673 TGTAATCCCAGGTACTCGCAAGG - Intergenic
1026230541 7:68479404-68479426 TGTAATCCCAAATACTCGGGAGG + Intergenic
1026250161 7:68662942-68662964 TGTAATCCCAAATACTTGGGAGG + Intergenic
1026291476 7:69010277-69010299 TGTAGTCCCAGATACTAGAAAGG - Intergenic
1026358901 7:69584615-69584637 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1026422500 7:70255193-70255215 TGTAATCCCCACTACTCGGGAGG - Intronic
1026646771 7:72177641-72177663 TGTAATCCCAACTACTTGGAAGG + Intronic
1026743239 7:72991714-72991736 TGTAATCCCAGATACTCGGAAGG - Intergenic
1026782726 7:73280774-73280796 TGTAATCCCAGATACTCGGAAGG - Intergenic
1026803105 7:73412168-73412190 TGTAATCCCATATACTCGGAAGG - Intergenic
1026894408 7:74001603-74001625 TGTAATCCCAGATACTAGGGAGG - Intergenic
1026935619 7:74253600-74253622 TGTAATCCCAGCTACTAGGAAGG + Intronic
1027006304 7:74696446-74696468 TGTAATCCCAGCTACTAGAAAGG - Intronic
1027057565 7:75060550-75060572 TGTAATCCCAGCTACTAGGAAGG - Intronic
1027100496 7:75373364-75373386 TGTAATCCCAGATACTCGGAAGG + Intergenic
1027247786 7:76379087-76379109 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1027400803 7:77804445-77804467 TGTAATCCCAGCTACTCGCAAGG - Intronic
1028360443 7:89960957-89960979 TGTAATCCCAATTACTAGGGAGG + Intergenic
1029061686 7:97805092-97805114 TGTAATCCCAGATACTAGGGAGG + Intergenic
1029272265 7:99384329-99384351 TGTAATCCCAAATACTTGGCAGG + Intronic
1029743598 7:102504877-102504899 TGTAATCCCAGCTACTAGGAAGG + Intronic
1029761584 7:102604040-102604062 TGTAATCCCAGCTACTAGGAAGG + Intronic
1030074253 7:105722761-105722783 TGTAATCCCCACTACTCGGGAGG + Intronic
1030309508 7:108055306-108055328 TGTAATCCCCACTACTTGGGAGG - Intronic
1030770168 7:113464643-113464665 TTTCATCTCCAATTCTAGCATGG + Intergenic
1031164447 7:118212474-118212496 TGTAATCCCCAGTACTGGAGGGG + Intergenic
1031237451 7:119195191-119195213 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1031554190 7:123151200-123151222 TGTAATCCCCACTACTTGGGAGG + Intronic
1031982062 7:128134503-128134525 TGTAATCCCAACTACTTGGAAGG + Intergenic
1031988520 7:128179597-128179619 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1032123885 7:129177002-129177024 TGTAATCACCACTACAATCAAGG + Intergenic
1032135517 7:129273448-129273470 TGTAATCCCAGATACTAGGGAGG - Intronic
1032645110 7:133815257-133815279 TGTAATCCCAGATACTAGGGAGG + Intronic
1032830023 7:135613656-135613678 TGTAATCCCAACTACTCGGAAGG - Intronic
1033063611 7:138130803-138130825 TGTAATCCCCAATGTTAAAAGGG - Intergenic
1033110932 7:138575412-138575434 TGTAGTCCCCACTACTGGGAAGG - Intronic
1033247532 7:139730480-139730502 TGTAATCCCCACTACTCGGGAGG - Intronic
1033458996 7:141528381-141528403 TGTAATCCCTTGGACTAGCATGG + Intergenic
1033526151 7:142215634-142215656 TGTAATCCCCACTACTTGGGAGG + Intronic
1033996957 7:147362252-147362274 TGTAATCCCCGCTACTTGAAAGG - Intronic
1034008723 7:147504565-147504587 TGTAATCCCAAATACTCGGGAGG + Intronic
1034308313 7:150064441-150064463 TGTAATCCCAGCTACTGGCAAGG + Intergenic
1034323074 7:150203685-150203707 TGTAATCCCCACTACTTGGAAGG - Intergenic
1034627723 7:152506326-152506348 TGTAATCCCAACTACTAGGGAGG - Intergenic
1034798540 7:154036230-154036252 TGTAATCCCAGCTACTGGCAAGG - Intronic
1035000164 7:155606290-155606312 TGTAATCCCCACTACTTGGGAGG - Intergenic
1035412842 7:158659205-158659227 TGTAATCCCAACTACTCGGAAGG + Intronic
1035759599 8:2059862-2059884 TGTAATCCCCACTACTGGGGAGG - Intronic
1035858145 8:2999275-2999297 TGTAATCCCAGCTACTAGGAGGG - Intronic
1036200020 8:6762910-6762932 TGTAATCCCAAATACTTGGGAGG - Intergenic
1036415118 8:8539742-8539764 TGTAATCCCCATTACTTGGGAGG + Intergenic
1036540460 8:9702892-9702914 TGTAATCCCAAATACTCGGGAGG + Intronic
1037237684 8:16740108-16740130 TGTGATCCCAACTACTGGCAAGG - Intergenic
1037263125 8:17029352-17029374 TGTAATCCCAGCTACTGGCAAGG + Intronic
1037321655 8:17649176-17649198 TGTAATCCCAAGTACTGGGAAGG - Intronic
1037346025 8:17902200-17902222 TGTAATCCCAACTACTAGGGAGG + Intronic
1037445983 8:18966447-18966469 TGTAATCCCAACTACTCGCAAGG + Intronic
1037633468 8:20678874-20678896 TGTAATCCCAGATACTTGAAAGG - Intergenic
1037656593 8:20888937-20888959 TGTAATCCCAGCTACTTGCAAGG + Intergenic
1037781894 8:21875192-21875214 TGTAATCCCAACTACTAGGGAGG - Intergenic
1038069839 8:24001836-24001858 TGTAATCCCCACTACTCGGGAGG - Intergenic
1038522761 8:28247547-28247569 TGTAATCCCAGCTACTCGCAAGG - Intergenic
1038572027 8:28671100-28671122 TGTAATCCCAACTACTGGCGAGG - Intronic
1038587949 8:28808313-28808335 TGTAATCCCAAATACTCGGGAGG - Intronic
1038721386 8:30039234-30039256 TGTAATCCCAACTACTTGGAAGG + Intergenic
1038741053 8:30217268-30217290 TGTATTCCCCACTACTTGGAAGG + Intergenic
1039396324 8:37228148-37228170 TGTAATCCCAACTACTAGGGAGG + Intergenic
1039522025 8:38179276-38179298 TGTAATCCCAGCTACTAGGAAGG - Intronic
1039629179 8:39090292-39090314 TGTAATCCCAACTACTTGGAAGG - Intronic
1039634437 8:39147893-39147915 TGTAATCCCAAATACTCGGGAGG - Intronic
1039820219 8:41128164-41128186 TGTAATCCCCAAGACAGGCCGGG + Intergenic
1040050002 8:43004557-43004579 TGTAATCCCAGCTACTTGCAAGG + Intronic
1040059123 8:43089237-43089259 TGTAATCCCAGCTACTGGCAAGG - Intergenic
1040077784 8:43257494-43257516 TGTAATCCCAACTACTAGGGAGG - Intergenic
1040870014 8:52090947-52090969 TGTAATCCCCATTACTCGGGAGG - Intergenic
1041190144 8:55345170-55345192 TGTAATCCCCACTACTTGGGAGG + Intronic
1041355663 8:56996851-56996873 TGTAATCCCAGATACTTGCGAGG + Intergenic
1041533142 8:58894772-58894794 TGTAATCCCAAATACTCGGGAGG + Intronic
1042026632 8:64430954-64430976 TGTAATCCCCACTACTTGGGAGG + Intergenic
1042131745 8:65594090-65594112 TGTAATCCCAGCTACTCGCAAGG + Intergenic
1042132022 8:65596498-65596520 TGTAATCCCAAATACTCGGGAGG + Intergenic
1042518675 8:69686705-69686727 TGTAAGCCCCAACACTGGCAGGG + Intronic
1042547641 8:69965278-69965300 TGTAATCCCCACTACTCGGGAGG - Intergenic
1043082076 8:75779233-75779255 TGTAATCCCCACTACTTGGGAGG + Intergenic
1043447916 8:80337447-80337469 TGTAGTCCCAACTACTTGCAAGG + Intergenic
1043453350 8:80390830-80390852 TGTAATCCCCACTACTTGGGAGG + Intergenic
1043461574 8:80465703-80465725 TGTAATCCCAGATACTTGGAAGG - Intergenic
1043560232 8:81484917-81484939 TGTAATCCCCGCTACTAGGGAGG - Intergenic
1043876772 8:85494401-85494423 TGTAATCCCAACTACTAGGGAGG - Intergenic
1044867774 8:96589532-96589554 TGTAATCCCAGCTACTCGCAAGG - Intronic
1045033002 8:98155400-98155422 TGTAATCCCAGATACTAGGGAGG - Intronic
1045255388 8:100515992-100516014 TGTAATCCCAACTACTTGAAAGG - Intronic
1045345562 8:101290659-101290681 TGTAATCCCCACTACTTGGGAGG - Intergenic
1045806827 8:106171860-106171882 TGTAATCCCAACTACTCACAAGG + Intergenic
1046158249 8:110322598-110322620 TGTAATCCCAGCTACTAGAAAGG + Intergenic
1046277671 8:111984779-111984801 TGTAATCCCCAATACTGGGGAGG - Intergenic
1046355383 8:113077578-113077600 TGTAATCCCAGCTACTAGCAGGG + Intronic
1046861126 8:119092782-119092804 TGTAATCCCCACTACTGGGGAGG + Intronic
1046916239 8:119680964-119680986 TGTAATCCCCGCTACTAGGGAGG + Intergenic
1046961765 8:120120869-120120891 TGTAATCCCCAATACTAGGGAGG - Intronic
1046963210 8:120131966-120131988 TGTAATCCCAACTACTAGAGAGG - Intronic
1047039258 8:120974471-120974493 TGTAATCCCAGATACTTGGAAGG + Intergenic
1047071086 8:121344367-121344389 TGTAATCCCCGCTACTAGGGAGG - Intergenic
1047450745 8:124963160-124963182 TGTAATCCCAACTACTAGGGAGG - Intergenic
1047458766 8:125041517-125041539 TGTAATCCCAGATACTTGGAAGG + Intronic
1047530155 8:125667177-125667199 TGTTATCCCAACTACTAGGAAGG - Intergenic
1047729519 8:127715249-127715271 TGTAATCCCAGATACTAGGGAGG + Intergenic
1049112255 8:140654200-140654222 TGTAATCCCAACTACTAGTTGGG - Intergenic
1051985169 9:23076541-23076563 TGTAATCCCCCCTACTAGGGAGG - Intergenic
1052007008 9:23360917-23360939 TGTAATCCCAAATACTGGGGAGG - Intergenic
1052293834 9:26875262-26875284 TGTAATCCCAGATACTTGGAAGG + Intronic
1052547381 9:29897665-29897687 TGTAATCCCAGCTACTTGCAAGG - Intergenic
1053080637 9:35173543-35173565 TGTAATCCCAACTACTCGCGAGG - Intronic
1053241124 9:36496561-36496583 TGTAATCCCAGATACTAGAGAGG - Intergenic
1053359063 9:37470333-37470355 TGTAATCCCAACTACTAGGGAGG - Intergenic
1055035163 9:71810694-71810716 TGTAATCCCAGCTACTAGCAGGG + Intronic
1055099363 9:72447231-72447253 TGTAACCCCCAATACTGGAGAGG + Intergenic
1055609982 9:78012357-78012379 TGTAATCCCAGCTACTTGCAAGG - Intronic
1055655998 9:78451072-78451094 TGTAATCCCAGCTACTAGCGAGG + Intergenic
1055944255 9:81678691-81678713 TGTAATCCCGGATACTTGGAAGG + Intronic
1056147087 9:83743039-83743061 TGTAATCCCAACTACTTGGAAGG + Intronic
1056174060 9:84017149-84017171 TGTAATCCCAGATACTCGGAAGG - Intergenic
1056648339 9:88434928-88434950 TGTAATCCCCACTACTTGGGAGG + Intronic
1057084778 9:92199184-92199206 TGTAATCCCCACTACTCACAAGG + Intergenic
1057091309 9:92260531-92260553 TGTAATCCCCACTACTGGGGAGG + Intronic
1058323995 9:103672412-103672434 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1058470703 9:105275924-105275946 TGTAATCCCCGCTACTAGGGAGG - Intronic
1059291515 9:113228966-113228988 TGTAATCCCAGATACTAGGGAGG - Intronic
1059607635 9:115851779-115851801 TGTAATCCCCACTACTCGGGAGG - Intergenic
1059869193 9:118552391-118552413 TGGAATTCCAAATTCTAGCATGG + Intergenic
1059878997 9:118668745-118668767 TGTAATCCCAAATACTTGGGAGG - Intergenic
1059925619 9:119206292-119206314 TGTAATCCCAGCTACTCGCAAGG + Intronic
1059934857 9:119299489-119299511 TGTAATCCCAGCTACTAGGAAGG + Intronic
1060420282 9:123463785-123463807 TGTAATCCCAAATACTTGGGAGG + Intronic
1061144572 9:128790133-128790155 TGTAATCCCAGCTACTTGCAAGG + Intronic
1061248238 9:129412556-129412578 TGTAATCCCCGCTACTAGGGAGG - Intergenic
1061511639 9:131064917-131064939 TGTAATCCCAGATACTCGCGAGG + Intronic
1061970836 9:134044367-134044389 TGTCATCCACAATAATACCATGG + Intronic
1062515306 9:136931056-136931078 TGTAATCCCAAATACTTGGAAGG - Intronic
1062539840 9:137036659-137036681 TGTAATCCCAAATACTCGGGAGG + Exonic
1062576397 9:137210723-137210745 TGTAATCCCCACTACTTGGGAGG + Intronic
1203483713 Un_GL000224v1:31729-31751 TGTAATCCCAAATACTTGGGAGG - Intergenic
1203707141 Un_KI270742v1:62369-62391 TGTAATCCCAGCTACTAGGAAGG + Intergenic
1203548262 Un_KI270743v1:146208-146230 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1185737717 X:2505724-2505746 TGTAATCCCAGCTACTCGCAAGG - Intergenic
1186446624 X:9635377-9635399 TTTAATCCCAAATAAAAGCATGG - Intronic
1187023419 X:15408066-15408088 TGTAATCCCAGCTACTAGGAAGG - Intronic
1187157470 X:16734255-16734277 TGTAATCCCAGCTACTTGCAGGG + Intronic
1187350896 X:18516107-18516129 TGTAATCCCAGATACTCGGAAGG - Intronic
1188323695 X:28773193-28773215 TGTAGTCCCAACTACTAGGAAGG - Intronic
1188500487 X:30820487-30820509 TGTAATCCCAAATACTTGGGAGG - Intergenic
1189300386 X:39948194-39948216 TGTAATCCCAACTACTAGGGAGG + Intergenic
1189395539 X:40619328-40619350 TGTAATCCCAGCTACTAGCGAGG + Intergenic
1189808111 X:44755176-44755198 TGTAATCCCAACTACTCGGAAGG - Intergenic
1189915969 X:45856186-45856208 TGTAATCCCAGTTACTCGCAAGG + Intergenic
1190091399 X:47440630-47440652 TGTAATCCCCACTACTCGGGAGG - Intergenic
1190274144 X:48889690-48889712 TGTAATCCCAGCTACTTGCACGG - Intergenic
1190293797 X:49012107-49012129 TGTAATCCCAACTACTAGGGAGG - Intergenic
1190295779 X:49026587-49026609 TGTAATCCCAGCTACTCGCAAGG + Intergenic
1190778726 X:53576954-53576976 TGTCATCCCTGATACTATCAAGG - Exonic
1192126504 X:68505286-68505308 TGTAATCCCAACTACTAGGGGGG + Intronic
1192364873 X:70463267-70463289 TGTAATCCCAACTACTTGGAAGG - Intronic
1192413363 X:70954450-70954472 TGTAATCCCAGCTACTAGCGGGG + Intergenic
1192439086 X:71161650-71161672 TGTAATCCCAGCTACTCGCAAGG + Intronic
1192454063 X:71262951-71262973 TGTAATCCCAACTACTAGGGAGG - Intergenic
1193420557 X:81278082-81278104 TGTAATCCCCGCTACTTGGAAGG - Intronic
1193737338 X:85174442-85174464 TGTAATCCCAAATACTCGGGAGG - Intergenic
1194652701 X:96534251-96534273 TGTAATCCCAACTACTAGGGAGG + Intergenic
1194696770 X:97062373-97062395 GGTAATTCCAAATATTAGCAAGG - Intronic
1194868404 X:99097662-99097684 TGTAATCCCCGCTACTGGGAAGG + Intergenic
1195218711 X:102725646-102725668 TGTAATCCCAGCTACTAGCGGGG - Intronic
1195365876 X:104124962-104124984 TGTAATCCCAGCTACTAGGAAGG - Intronic
1195900925 X:109796432-109796454 TGTAATCCCAGATACTAGGGAGG + Intergenic
1195926471 X:110030687-110030709 TGTAATCCCAGATACTAGGGAGG + Intronic
1196347905 X:114688197-114688219 TGTAATCCCAGCTACTAGCGAGG + Intronic
1196434669 X:115664115-115664137 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1196707903 X:118731453-118731475 TGTAATCCCAACTACTCGGAAGG + Intronic
1196832069 X:119783542-119783564 TGTAATCCCAACTACTCGGAAGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1196923782 X:120611539-120611561 TGTAATCCCAACTACTTGGAAGG - Intronic
1197194497 X:123684503-123684525 TGTAATCCCCACTACTCGGGAGG - Intronic
1197233912 X:124037005-124037027 TGTAATCCCAACTACTCGCGAGG - Intronic
1198195416 X:134355806-134355828 TGTAATCCCGGCTACTCGCAAGG + Intergenic
1198462920 X:136880531-136880553 TATAATCCCCAGTCCTAACACGG + Intronic
1198516133 X:137409230-137409252 TGTAGTCCCCAGTACTAGGGAGG - Intergenic
1198682511 X:139197870-139197892 TGTAATCCCAGCTACTAGGAAGG + Intronic
1199141157 X:144314365-144314387 TGTAATCCCAACTACTCGCAAGG - Intergenic
1199221340 X:145319493-145319515 TGTAATCCCCGATACTTGGGAGG - Intergenic
1199290756 X:146102634-146102656 TGTAATCCCAGCTACTAGGAAGG - Intergenic
1199952778 X:152718654-152718676 TAGAATCCCCACTACTACCAGGG - Intergenic
1199956905 X:152749794-152749816 TAGAATCCCCACTACTACCAGGG + Intergenic
1200177655 X:154128272-154128294 TGTAATCCCAATTACTAGGGAGG + Intergenic
1200378076 X:155805244-155805266 TGTAATCCCCACTACTTGGGAGG + Intergenic
1201365609 Y:13203444-13203466 TTTAATCCCAAATACTAGGGAGG + Intergenic
1201541582 Y:15110690-15110712 TGGAATCCTCACTGCTAGCACGG - Intergenic
1202080036 Y:21074798-21074820 TGTAATCCCAACTACTAGGGAGG - Intergenic
1202582821 Y:26400077-26400099 TGTAATCCCAGCTACTAGGAAGG + Intergenic