ID: 1107908892

View in Genome Browser
Species Human (GRCh38)
Location 13:45086786-45086808
Sequence TGTGACCTTACTTGGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6086
Summary {0: 33, 1: 441, 2: 1219, 3: 1764, 4: 2629}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107908892_1107908896 -8 Left 1107908892 13:45086786-45086808 CCTTATTTCCAAGTAAGGTCACA 0: 33
1: 441
2: 1219
3: 1764
4: 2629
Right 1107908896 13:45086801-45086823 AGGTCACATTCTGAGGTTTTGGG No data
1107908892_1107908895 -9 Left 1107908892 13:45086786-45086808 CCTTATTTCCAAGTAAGGTCACA 0: 33
1: 441
2: 1219
3: 1764
4: 2629
Right 1107908895 13:45086800-45086822 AAGGTCACATTCTGAGGTTTTGG 0: 6
1: 106
2: 419
3: 970
4: 1775
1107908892_1107908897 8 Left 1107908892 13:45086786-45086808 CCTTATTTCCAAGTAAGGTCACA 0: 33
1: 441
2: 1219
3: 1764
4: 2629
Right 1107908897 13:45086817-45086839 TTTTGGGTAAATATGAATTTTGG No data
1107908892_1107908899 12 Left 1107908892 13:45086786-45086808 CCTTATTTCCAAGTAAGGTCACA 0: 33
1: 441
2: 1219
3: 1764
4: 2629
Right 1107908899 13:45086821-45086843 GGGTAAATATGAATTTTGGAGGG No data
1107908892_1107908898 11 Left 1107908892 13:45086786-45086808 CCTTATTTCCAAGTAAGGTCACA 0: 33
1: 441
2: 1219
3: 1764
4: 2629
Right 1107908898 13:45086820-45086842 TGGGTAAATATGAATTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107908892 Original CRISPR TGTGACCTTACTTGGAAATA AGG (reversed) Intergenic
Too many off-targets to display for this crispr