ID: 1107908893

View in Genome Browser
Species Human (GRCh38)
Location 13:45086794-45086816
Sequence CCTCAGAATGTGACCTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6358
Summary {0: 14, 1: 414, 2: 1008, 3: 1935, 4: 2987}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107908893_1107908897 0 Left 1107908893 13:45086794-45086816 CCAAGTAAGGTCACATTCTGAGG 0: 14
1: 414
2: 1008
3: 1935
4: 2987
Right 1107908897 13:45086817-45086839 TTTTGGGTAAATATGAATTTTGG No data
1107908893_1107908899 4 Left 1107908893 13:45086794-45086816 CCAAGTAAGGTCACATTCTGAGG 0: 14
1: 414
2: 1008
3: 1935
4: 2987
Right 1107908899 13:45086821-45086843 GGGTAAATATGAATTTTGGAGGG No data
1107908893_1107908898 3 Left 1107908893 13:45086794-45086816 CCAAGTAAGGTCACATTCTGAGG 0: 14
1: 414
2: 1008
3: 1935
4: 2987
Right 1107908898 13:45086820-45086842 TGGGTAAATATGAATTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107908893 Original CRISPR CCTCAGAATGTGACCTTACT TGG (reversed) Intergenic
Too many off-targets to display for this crispr