ID: 1107908899

View in Genome Browser
Species Human (GRCh38)
Location 13:45086821-45086843
Sequence GGGTAAATATGAATTTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107908893_1107908899 4 Left 1107908893 13:45086794-45086816 CCAAGTAAGGTCACATTCTGAGG 0: 14
1: 414
2: 1008
3: 1935
4: 2987
Right 1107908899 13:45086821-45086843 GGGTAAATATGAATTTTGGAGGG No data
1107908892_1107908899 12 Left 1107908892 13:45086786-45086808 CCTTATTTCCAAGTAAGGTCACA 0: 33
1: 441
2: 1219
3: 1764
4: 2629
Right 1107908899 13:45086821-45086843 GGGTAAATATGAATTTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107908899 Original CRISPR GGGTAAATATGAATTTTGGA GGG Intergenic
No off target data available for this crispr