ID: 1107911987

View in Genome Browser
Species Human (GRCh38)
Location 13:45114145-45114167
Sequence CTGAGTTATCACTTGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107911984_1107911987 26 Left 1107911984 13:45114096-45114118 CCCAGAAGGAGCAATGCTGTGTG No data
Right 1107911987 13:45114145-45114167 CTGAGTTATCACTTGGTAGATGG No data
1107911985_1107911987 25 Left 1107911985 13:45114097-45114119 CCAGAAGGAGCAATGCTGTGTGT No data
Right 1107911987 13:45114145-45114167 CTGAGTTATCACTTGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107911987 Original CRISPR CTGAGTTATCACTTGGTAGA TGG Intergenic
No off target data available for this crispr