ID: 1107923603

View in Genome Browser
Species Human (GRCh38)
Location 13:45235893-45235915
Sequence ATAAAGTATCTGGCCATGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 485}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107923603 Original CRISPR ATAAAGTATCTGGCCATGTG CGG (reversed) Intronic
900267548 1:1766157-1766179 AGAAAGACTCTGGCCAGGTGCGG + Intronic
900724720 1:4208474-4208496 ATAAAGGAACTGGCCAGGTGGGG + Intergenic
901542727 1:9931007-9931029 ATAAATTTTATGGCCAGGTGCGG - Intronic
902469322 1:16637571-16637593 AAAAAGTATGTGGCCGGGTGCGG + Intergenic
902865692 1:19276819-19276841 ATAAATTAACAGGCCAGGTGTGG + Intergenic
903383060 1:22909983-22910005 ATCAAGCATGTGGCCATGTGGGG + Intronic
903604936 1:24568546-24568568 ATAAAGTCTCTGGCAGTGTTTGG - Intronic
904394049 1:30206125-30206147 ATAAGGGAGCTGGGCATGTGGGG - Intergenic
905484805 1:38287936-38287958 AAAAAATATCTGGCAATGCGTGG + Intergenic
905573186 1:39022567-39022589 ACAAATTATCTGGCCACGTGCGG - Intergenic
905760464 1:40552680-40552702 TAAAAGTTTCTGGCCAGGTGTGG + Intergenic
906043789 1:42811313-42811335 GTAAAATATATGGCCTTGTGAGG - Intronic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
911767399 1:101694255-101694277 ATCAATTATGTGGCCAGGTGTGG + Intergenic
913240978 1:116829030-116829052 ATATTTTATCTGGCCAGGTGCGG - Intergenic
914438146 1:147679103-147679125 ATGTAGTATGTGGCCAGGTGTGG + Intergenic
914685818 1:149978214-149978236 ATACAGTATTAGGCCAGGTGCGG + Intronic
915059314 1:153167182-153167204 ATAAAATCTCTGGCCAGGCGTGG + Intergenic
916229402 1:162525048-162525070 ATAAAACATCTAGCCAGGTGTGG - Exonic
916846776 1:168659153-168659175 ACACAGTATCTGGCCAGGTACGG - Intergenic
917362064 1:174187463-174187485 ATAAAGTGTCAGGCACTGTGGGG + Intronic
917558898 1:176123629-176123651 ATAAAGTTTCTGGGCTTGAGAGG - Intronic
917815644 1:178707246-178707268 ATTAAGGACCTGGCCAGGTGCGG + Intergenic
919400848 1:197114727-197114749 ATAAAATAACTAGCCAAGTGTGG - Intronic
920026429 1:203001319-203001341 ATATAGTATATGGCCAGGTGTGG - Intergenic
920307073 1:205025776-205025798 ATAAATTATCTGGGCATAAGTGG - Intergenic
920937668 1:210450566-210450588 ATAAAAGATATGGCCAGGTGCGG - Intronic
921266491 1:213424969-213424991 ACAAAGTGGCTGGCTATGTGAGG - Intergenic
921720668 1:218467292-218467314 ATAAAGCAGCTGGTCTTGTGTGG - Intergenic
921982208 1:221271159-221271181 ATAGAGAATATGGCCAGGTGCGG - Intergenic
922558837 1:226552470-226552492 ACAAACTCTCTGGCCATGTTGGG - Intronic
923394026 1:233543154-233543176 ATAAAGGATCTGTTCAGGTGTGG - Intergenic
923589164 1:235303211-235303233 ATAAACTCTCTGGCCGGGTGTGG - Intronic
924017854 1:239747044-239747066 ATAGAGTAACAGGCCAGGTGTGG - Intronic
924072825 1:240299236-240299258 ATAAAAACTCAGGCCATGTGTGG - Intronic
924155506 1:241171776-241171798 TTAAAGTATCTGGTTATGTGAGG - Intronic
924480091 1:244422405-244422427 CTAAAGAATCTGGCCCTATGGGG + Intronic
924684858 1:246278483-246278505 ATAAAGTACATGGTCATGTGGGG + Intronic
924802717 1:247339164-247339186 AAAAAGTATCTGGCTGGGTGTGG + Intergenic
924871546 1:248052436-248052458 AGAAAGTATATGGCCTGGTGCGG + Intronic
1064393610 10:14961768-14961790 ATAAACGTTTTGGCCATGTGCGG - Intronic
1065360602 10:24885693-24885715 ATAAAGCTGCTGGCCAGGTGCGG - Intronic
1066556854 10:36623635-36623657 ATAAATCTTCTGGCCAGGTGCGG - Intergenic
1067190996 10:44068267-44068289 CTAAAGTTTCTGGCTCTGTGGGG + Intergenic
1067268110 10:44764994-44765016 AGAATGTATCTGGCCATATGGGG - Intergenic
1068047244 10:51902404-51902426 ATAAAGTTTAAGGCCAGGTGTGG - Intronic
1068179567 10:53502008-53502030 ATAAAGGAACTGGGCAGGTGGGG + Intergenic
1069376591 10:67799592-67799614 ATGTAGTTTCTGGCCAGGTGCGG + Intronic
1069483508 10:68805483-68805505 ATGATGTAGCTGGCCAAGTGTGG + Intergenic
1069511601 10:69046689-69046711 ATATATCATCTGGCCAGGTGTGG + Intergenic
1069919916 10:71810285-71810307 AAATAGTACCTGGCCAAGTGTGG + Intronic
1070294866 10:75151977-75151999 CTAAAGTACCTGGCCAAGCGCGG - Intronic
1070869683 10:79739740-79739762 ATAAAATAATTGGCCATGTGTGG + Intergenic
1071556710 10:86609122-86609144 AAAAAGCTTCTGGCCAGGTGTGG - Intergenic
1071636602 10:87261949-87261971 ATAAAATAATTGGCCATGTGTGG + Intergenic
1071658647 10:87476000-87476022 ATAAAATAATTGGCCATGTGTGG - Intergenic
1071914988 10:90284073-90284095 ATAAAATAATTAGCCATGTGTGG + Intergenic
1072271664 10:93783085-93783107 AGAATGTTTCTGGCCAGGTGCGG + Intronic
1072868852 10:99094845-99094867 ATAAGGTATTTGGCCTGGTGTGG - Intronic
1074473413 10:113747672-113747694 ATAAAGAATCTGGCCTTGTCTGG + Intergenic
1074548084 10:114417348-114417370 ATAGACTTTCTGGCCAAGTGTGG - Intergenic
1074555865 10:114489305-114489327 ATAAAGATTTTGGCCAGGTGTGG - Intronic
1074744106 10:116514364-116514386 ATTAATTATCTGGGCATATGTGG - Intergenic
1074841655 10:117358830-117358852 ATAAGGCATCTGGCCCAGTGAGG + Intronic
1074998448 10:118777657-118777679 AAAAAGTATCAGGCCAGGCGCGG - Intergenic
1075404490 10:122185484-122185506 ATAAAGAGTATGGCCAGGTGCGG - Intronic
1075507984 10:123042736-123042758 ATAAAGTTTTAGGCCAGGTGCGG - Intronic
1075610860 10:123853612-123853634 AGAAAGAATCTGGCCAGGTGTGG + Intronic
1078727712 11:13946454-13946476 AAGAAGTATCTGGCCAGATGCGG - Intergenic
1079152784 11:17915912-17915934 CTAAAGAGTCTGGCCAGGTGAGG + Intronic
1080851014 11:36070200-36070222 ATAAAGAATCTGCCCCTGTTTGG - Intronic
1081123958 11:39300052-39300074 ATAAAATTTATGGCCAGGTGCGG - Intergenic
1085361860 11:75895765-75895787 TTGCAGTATCTGGCCAGGTGTGG - Intronic
1086031052 11:82356146-82356168 ATAAAGTGTCTTGCCGTGTTGGG - Intergenic
1087039266 11:93783150-93783172 AGAAAGTAGATGGCCGTGTGTGG - Intronic
1087756037 11:102055636-102055658 GTAATGTATATGGCCAGGTGTGG - Intronic
1089028677 11:115299298-115299320 ATAAAGTCAGTGGCCATTTGTGG - Intronic
1089396438 11:118139019-118139041 AGAAAGGATCTGGCCATGGTGGG - Intronic
1091496016 12:973357-973379 TTAAAATTTCTGGCCAGGTGTGG - Intronic
1091506319 12:1073009-1073031 ATAAATTTTCAGGCCAGGTGCGG + Intronic
1092842552 12:12557163-12557185 TTAAAGTTTCTGGCCGGGTGTGG + Intronic
1095693984 12:45123448-45123470 ATAAAGGTTTTGGCCAGGTGCGG + Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1095739327 12:45590076-45590098 ATAAAATATTAGGCCAGGTGTGG + Intergenic
1096397107 12:51274535-51274557 ATAATGTATCAGGCCAGGCGTGG - Intergenic
1097343203 12:58463048-58463070 AAGAAATATCTGGCCAGGTGTGG - Intergenic
1098904721 12:76150417-76150439 ATAAAGATTTTGGCCAGGTGTGG + Intergenic
1099099908 12:78425858-78425880 ATAAAGCAAATGGCCATGTTAGG - Intergenic
1099148339 12:79076349-79076371 ATAATGTATCTTGGCATTTGAGG - Intronic
1099268462 12:80478277-80478299 TTGGAGTACCTGGCCATGTGAGG - Intronic
1099841697 12:87975008-87975030 TTGGAGTACCTGGCCATGTGAGG + Intergenic
1099872883 12:88370413-88370435 ATAAAGGAACTGGGCAGGTGGGG - Intergenic
1101215232 12:102575104-102575126 ATAAAATATCTGGCTGGGTGTGG + Intergenic
1101450433 12:104772452-104772474 AAAAAATATCTGGCCAAGTGTGG - Intergenic
1102073380 12:110040365-110040387 TTAAAGTTTCTGGCCGAGTGCGG - Intronic
1102110920 12:110365275-110365297 AAAAATTATCTGGCCATGGTGGG + Intergenic
1102506837 12:113389196-113389218 CCAAAGTTTCTGGCCATCTGTGG + Exonic
1103176982 12:118872698-118872720 AAAATGGATCTGGCCAGGTGTGG - Intergenic
1105205296 13:18218195-18218217 ATAAAAAATCAGGCCAGGTGTGG - Intergenic
1105718340 13:23089511-23089533 ATAAAATATCTGGCAAGGTGTGG - Intergenic
1106427800 13:29649480-29649502 ATAAAATATTTGGCCAGGTGTGG + Intergenic
1106714877 13:32377299-32377321 ATAAAATAGCTGGCCAGGCGCGG + Intronic
1107036014 13:35903297-35903319 AGAAAGTGTCTGGCCATAAGAGG + Intronic
1107254041 13:38401915-38401937 AAAAGGTATCTTGCCAGGTGTGG + Intergenic
1107498208 13:40949274-40949296 TTAAAGTATTGGGCCAGGTGCGG - Intronic
1107642577 13:42458899-42458921 TTAAAGTATCTTTCCAGGTGTGG - Intergenic
1107923603 13:45235893-45235915 ATAAAGTATCTGGCCATGTGCGG - Intronic
1108068134 13:46599940-46599962 TAAAGGTATTTGGCCATGTGCGG + Intronic
1108088951 13:46825420-46825442 ACAAAGTCTCTGCCCATGTAGGG + Intergenic
1108189456 13:47922708-47922730 ATAAAGTATTTGGCCGGGCGCGG + Intergenic
1108368839 13:49746817-49746839 ATAAAGTATCCAGTGATGTGTGG + Intronic
1108864529 13:54906602-54906624 ATTAAGTTACTGGCCAGGTGTGG + Intergenic
1109278100 13:60324205-60324227 ATAAGACATCTGGCCAGGTGTGG - Intergenic
1110113228 13:71777824-71777846 ATAAATTATAAGGCCAGGTGTGG + Intronic
1112651689 13:101406023-101406045 ATACATTTTCAGGCCATGTGTGG + Intronic
1112867434 13:103922562-103922584 ATACAGAATCTGGCCAGGCGTGG - Intergenic
1112872072 13:103984665-103984687 AGAAAATATCTGGCCGTGTGCGG - Intergenic
1114194749 14:20467696-20467718 ACAATATATCTGGCCAGGTGTGG + Intergenic
1114421895 14:22590568-22590590 ATAAAGTACCTGGTCATGTGTGG - Intergenic
1114457362 14:22864822-22864844 AAAAATTAGCTGGCCAGGTGCGG - Intergenic
1114955877 14:27818640-27818662 TTAAAATATGTGACCATGTGTGG + Intergenic
1115600079 14:34947678-34947700 AGAAAGTATGTGGCCAGGTGCGG - Intergenic
1115784702 14:36811493-36811515 ATAAAATAACTAGCCAGGTGTGG + Intronic
1115886622 14:37979109-37979131 TTAAAGTTTTTGGCCAGGTGCGG + Intronic
1117317654 14:54589368-54589390 CTAAATTTTATGGCCATGTGTGG + Intronic
1118656520 14:67956207-67956229 GTTAAGTATCTGGCCGGGTGTGG + Intronic
1119044179 14:71302927-71302949 ATAAAGAAACTGGCCAGGTATGG - Intergenic
1119049688 14:71354565-71354587 ATGAAGTATCGGGCCAGGCGCGG - Intronic
1119371280 14:74146253-74146275 ATAATGTATCCAGCCGTGTGTGG - Intronic
1119543749 14:75457252-75457274 CTAAAGCATTTGCCCATGTGTGG - Intronic
1119590746 14:75885198-75885220 ATAAAAAAACTGGCCAGGTGCGG + Intronic
1119623446 14:76150824-76150846 ATAATGTATCGGGCCGGGTGAGG - Intergenic
1120440732 14:84535590-84535612 ATAAAGTATTTGGTGATGGGAGG + Intergenic
1120678953 14:87456118-87456140 CTAAAATATTTGGCCAGGTGTGG - Intergenic
1120800003 14:88677193-88677215 ATAGGGAATCTGGCCAGGTGTGG - Intronic
1120944923 14:89985736-89985758 ATAAATTCCCTGGCCAGGTGTGG + Intronic
1121256553 14:92534617-92534639 AGAAAGTATATGGACAAGTGTGG + Intronic
1122732474 14:103811370-103811392 ATAAAGGACTTGGCCAGGTGTGG + Intronic
1202829160 14_GL000009v2_random:7385-7407 CCAAATTATCTGGCCATTTGTGG + Intergenic
1123715158 15:23023072-23023094 ATACTGCATCTGACCATGTGGGG - Intronic
1124972857 15:34506628-34506650 ATACTGGATCTGGCCTTGTGCGG - Intergenic
1125077260 15:35633873-35633895 ATAAAGTCACAGGCCAGGTGTGG + Intergenic
1125178779 15:36857099-36857121 ATAAAGCTTCTGGCCAGGTGCGG - Intergenic
1126058713 15:44757700-44757722 ATAAAATAATTAGCCATGTGTGG - Intronic
1126067981 15:44840794-44840816 ATTAACTGTCTGGCCAGGTGTGG + Intergenic
1126091846 15:45059784-45059806 ATTAACTGTCTGGCCAGGTGTGG - Intronic
1126832195 15:52619553-52619575 ATAAATTATTTGGCCAGGTGTGG + Intronic
1127001728 15:54516510-54516532 AAAAAGAATCAGGCCAGGTGTGG + Intronic
1127812810 15:62579198-62579220 AAAAAATCACTGGCCATGTGAGG + Intronic
1128048724 15:64643271-64643293 TTATAGTTTCTGGCCAGGTGTGG - Intronic
1128952424 15:71900142-71900164 ATAAGTTTTCTGGCCAGGTGCGG + Intronic
1129024699 15:72559559-72559581 ATACAGTTGCTGGCCATGTGCGG - Intronic
1129372165 15:75104338-75104360 AATAAGTATCTGGCCGGGTGTGG - Intronic
1129984648 15:79907231-79907253 GTAGAGTATCTGGCCATTTGTGG - Intronic
1131010725 15:89016351-89016373 ATAAAGGTTTTGGCCAGGTGCGG - Intergenic
1131138865 15:89960987-89961009 ATAAAGTTTTTGGCCAGGTGCGG + Intergenic
1133628033 16:7590567-7590589 TTAAGATATCTGGCCGTGTGCGG + Intronic
1133686826 16:8173163-8173185 ATAAAGTCCTTGGCCAGGTGCGG + Intergenic
1135250108 16:20893974-20893996 ATAAAGGAGCAGGCCAGGTGTGG + Intronic
1135402169 16:22173518-22173540 ATAAAGAATGGGGCCAGGTGTGG - Intronic
1135592709 16:23715980-23716002 AGAAAATATCTGGACAGGTGTGG + Intergenic
1135661759 16:24303082-24303104 AAAAAATATTAGGCCATGTGCGG - Intronic
1136180626 16:28549241-28549263 ATAATTTTTCTGGCCAGGTGCGG - Intergenic
1137643537 16:50054727-50054749 AAAAAGTATCTGGCCCAGCGTGG + Intergenic
1139329775 16:66178291-66178313 AAAAATTATCTGGGCATGGGTGG - Intergenic
1139721478 16:68859459-68859481 ACAAAGGCTCTGGCCAGGTGCGG - Intronic
1140699013 16:77564115-77564137 ATGATGTTTCTGGCCAGGTGTGG + Intergenic
1141605134 16:85148548-85148570 ATAAGGAAACTGGCCAGGTGCGG + Intergenic
1142524408 17:529171-529193 ATCAAGTATCTACACATGTGTGG + Intronic
1142576510 17:912226-912248 ATAGAGTATTTGGCCGGGTGTGG - Intronic
1143229783 17:5343261-5343283 AATTATTATCTGGCCATGTGCGG + Intronic
1143441438 17:6977635-6977657 ATAAAATATCTGGCCAGGTGCGG + Intronic
1143491451 17:7287507-7287529 GGAAAGTATGTGCCCATGTGTGG + Exonic
1143674211 17:8419138-8419160 ATAAGGGATCAGGCCAGGTGTGG - Intronic
1143819378 17:9547351-9547373 AAAATATATCTGGCCAGGTGTGG + Intronic
1145851439 17:28102358-28102380 AAAAAGTTTTTGGCCAGGTGCGG + Intronic
1146134488 17:30306571-30306593 AAAAAGCCTCTGGCCAGGTGCGG - Intergenic
1146474231 17:33149935-33149957 ATGAATTATCTGGAAATGTGAGG - Intronic
1146666157 17:34705321-34705343 TTAAGATATCTGGCCAGGTGTGG + Intergenic
1147022904 17:37552802-37552824 ATCAAATTTCTGGCAATGTGAGG + Intronic
1147112809 17:38276307-38276329 AAAATGAATCTGGCCAGGTGCGG + Intergenic
1147487562 17:40832191-40832213 ATAAAATTTCTGGCCAAGGGTGG - Intronic
1149905306 17:60520850-60520872 ATGAAGTTTATGGCCAGGTGTGG - Intronic
1150255034 17:63737829-63737851 ATAAAAAAACTGGCCAGGTGTGG + Intronic
1150329729 17:64285228-64285250 ATAAAGCATCTTTCCAGGTGGGG - Intergenic
1150699596 17:67435561-67435583 ATACAGTTTCAGGCCAGGTGCGG + Intronic
1150829372 17:68505520-68505542 ATAATGTATCAGGCCAGGTGAGG + Intergenic
1151509812 17:74551248-74551270 TGAAAGTGTCTGGCCTTGTGGGG - Intergenic
1151737432 17:75952963-75952985 ATAAAGAAACTGGCCAGGTGTGG - Intronic
1152220181 17:79059824-79059846 GTAAAGTATCGGGCCAGGCGCGG + Intergenic
1152393915 17:80020291-80020313 AAAAAGTATAAGGCCAGGTGTGG + Intronic
1152826205 17:82466741-82466763 AGAATGTATCTGGCCGGGTGTGG - Intronic
1153139690 18:1956220-1956242 AGAAAATATTTGGCCAGGTGCGG - Intergenic
1153289690 18:3488651-3488673 ATAAAGCATATGGCCAGGTGCGG - Intergenic
1153838506 18:8985771-8985793 AGAAAAGATTTGGCCATGTGCGG + Intergenic
1154001538 18:10486059-10486081 ATGAAATCTCTGGCCAGGTGCGG + Intronic
1155411902 18:25555675-25555697 ATAAAGCATTTGGGCATGTGTGG + Intergenic
1155618757 18:27751566-27751588 TTAAAAAATCTGGCCAAGTGCGG + Intergenic
1156780094 18:40840364-40840386 ATAAAGTATCTGGCCAGGCACGG + Intergenic
1156848002 18:41691430-41691452 ATAGAGTATCGGGCCATGACTGG + Intergenic
1157262854 18:46191470-46191492 ATAATGTATCAGGCCAGGCGTGG - Intronic
1158820325 18:61151564-61151586 ATAAAAAATCTGGCCAGGTGTGG + Intergenic
1159835143 18:73327376-73327398 ATAAAGGAACTGGGCAGGTGGGG - Intergenic
1160355499 18:78225066-78225088 ATAAATTATCTCCCAATGTGTGG + Intergenic
1161493101 19:4573256-4573278 ATAAAATAGCTGGCCAGGCGCGG + Intergenic
1162215694 19:9131965-9131987 AAAAGGAATCTGGCCAAGTGCGG - Intergenic
1162415516 19:10534271-10534293 ATAAATTAGCTGGCCAGGCGCGG + Intergenic
1162467498 19:10851036-10851058 AAAAAGTATGTGGCCAAGAGGGG - Intronic
1162846250 19:13394975-13394997 AAAAATTATCTGGCCAGCTGTGG + Intronic
1163141592 19:15352857-15352879 ATAAAATATCAGGCCAGGTGTGG - Intergenic
1163408392 19:17137731-17137753 AAAAAGGATCTGACCATGGGAGG - Intronic
1163550682 19:17964983-17965005 AAAAAGCATCTGGCCAGGCGCGG + Intronic
1163650090 19:18512345-18512367 ATAAAGAAACAGGCCAGGTGCGG + Intronic
1163962348 19:20709014-20709036 AGAAAGTGTCTGGCCAGGCGCGG - Intronic
1164357892 19:27463599-27463621 GAAGAGTACCTGGCCATGTGAGG - Intergenic
1165014277 19:32869500-32869522 AAAAAGTACCTGGCCAGGCGTGG - Intronic
1166905701 19:46107028-46107050 ATAAGGTAACTGGGCAAGTGGGG + Intergenic
1167994825 19:53394071-53394093 AAAAAGTATTTGGCCAGGCGCGG + Intronic
1168331625 19:55573323-55573345 ATAAGGTGTCTGGCCATGGTAGG + Intergenic
1202643536 1_KI270706v1_random:120404-120426 CCAAATTATCTGGCCATTTGTGG - Intergenic
925431589 2:3799612-3799634 TTGGAGTACCTGGCCATGTGAGG + Intronic
926569704 2:14516390-14516412 TAAAAGAATCAGGCCATGTGTGG + Intergenic
926902614 2:17771051-17771073 ATAAAGTTGCTGGCCTAGTGTGG - Intronic
927043252 2:19251144-19251166 TTAAAGTATGTGGTCATTTGGGG - Intergenic
928357615 2:30634333-30634355 TTAAACCATCTGGCCATGCGCGG + Intronic
929611649 2:43275293-43275315 AAACAGTTTCTGGCCAGGTGCGG - Intronic
929684438 2:44022018-44022040 ATAAAGGAACTGGGCAGGTGGGG + Intergenic
930131582 2:47857409-47857431 ATAAAATTTCTGGCCAGGTGTGG - Intronic
930549790 2:52818893-52818915 TTAAAGTAGCTGGCCCAGTGTGG + Intergenic
930652507 2:53976495-53976517 ATTACGTTTCTGGCCAGGTGTGG - Intronic
930798145 2:55414773-55414795 ATAAGGTTCCTGGCCAGGTGTGG + Intronic
931753955 2:65355424-65355446 ATAAAATTTATGGCCAAGTGTGG + Intronic
932314561 2:70771058-70771080 TTAAACTATCTGGCCATGGAGGG - Intergenic
932626240 2:73298373-73298395 ATAAAGGATCTGGCTATATATGG + Intergenic
932799334 2:74726028-74726050 ATAAAGTATATGGCATTATGTGG + Intergenic
933112777 2:78425116-78425138 ACAAAGTATCTGTTCTTGTGGGG - Intergenic
933288290 2:80407994-80408016 CTGAAGTTTCTGGCCATTTGTGG - Intronic
933426266 2:82115709-82115731 ACAAAGAATTTGGCCATGAGAGG - Intergenic
933605538 2:84378439-84378461 ATAAATAAACTGGCCAGGTGTGG + Intergenic
934044681 2:88163018-88163040 ATGCAGAATCTGGCCAGGTGCGG + Intergenic
934695045 2:96393688-96393710 AAAAGGGATCTGGCCAGGTGCGG - Intergenic
935651952 2:105389936-105389958 AAAAAAAATCTGGCCAGGTGCGG + Intronic
935664699 2:105500195-105500217 ATACATTATCTGGCCAGGTGCGG - Intergenic
937444631 2:121947295-121947317 TTAAATTTTCTGGCCAGGTGCGG + Intergenic
937628085 2:124066565-124066587 ATCAAGTGTCTGACCAGGTGGGG - Intronic
937719630 2:125078774-125078796 AAGAAGAATCTGGCCAGGTGTGG - Intergenic
937807049 2:126158669-126158691 ATACAGTATCTTGCAATCTGGGG - Intergenic
938855612 2:135307354-135307376 ATAAAAAATCTGGCCGGGTGTGG - Intronic
939338262 2:140859702-140859724 ATAAATTGCCTGGCCGTGTGCGG + Intronic
939410529 2:141818948-141818970 AAAAACTTTCTGGCCAGGTGCGG + Intronic
939904179 2:147890183-147890205 ATATAGTATATGCACATGTGTGG - Intronic
939917698 2:148067799-148067821 AGAAAGTATATTGCCCTGTGTGG + Intronic
940207475 2:151219772-151219794 AAAAAATATCTAGCCAGGTGTGG - Intergenic
940755931 2:157683604-157683626 AGAAAGCCTCTGGCAATGTGAGG + Intergenic
941152933 2:161937980-161938002 TTAAAGTATCAGGCCAGGTACGG + Intronic
941452237 2:165673426-165673448 ATTAAGAATCTGGCCAGCTGTGG - Intronic
941815182 2:169788961-169788983 AAAAATTATCTGGGTATGTGTGG + Intergenic
942180486 2:173375776-173375798 ATAAAGTATGTGGACTTTTGTGG + Intergenic
942452213 2:176115518-176115540 ATAAAGTATCTTCCCGTGTGTGG + Intronic
944113517 2:196161804-196161826 TTATAATATCTGGCCAGGTGTGG - Intronic
945334016 2:208570394-208570416 GTAAACTATTTGGCCATTTGTGG - Intronic
945790792 2:214302771-214302793 ATGAAGTATTTGGCCAGGCGCGG - Intronic
945941442 2:215954991-215955013 ATAATGAATGTGGCCAGGTGAGG - Intronic
945946254 2:215998526-215998548 ACAAAGTACCTGGCCCTATGGGG + Intronic
947429719 2:230016413-230016435 CTAAAATATCTGGCCAGGTGCGG + Intergenic
947436279 2:230075101-230075123 AAAAAGTATCTGGGCGGGTGTGG + Intergenic
1169365416 20:4988309-4988331 AAAAAGTAGCTGACCGTGTGTGG + Intronic
1169791380 20:9413908-9413930 ATAAAAAAACTAGCCATGTGTGG - Intronic
1172349008 20:34226878-34226900 ATCAAGTATGGGGCCAGGTGTGG - Intronic
1172525155 20:35596367-35596389 ATCCAGAATCTGGCCAGGTGTGG + Intergenic
1174001001 20:47374624-47374646 ATAAAGCAACAGGCCAGGTGTGG - Intergenic
1174264671 20:49322839-49322861 ATATATCAACTGGCCATGTGGGG + Intergenic
1174350572 20:49964574-49964596 AAAAAGTATTTGGCCAGGTGCGG - Intergenic
1174364427 20:50047888-50047910 ATAAAGTACTTGGCCGAGTGCGG - Intergenic
1174823403 20:53746888-53746910 ATAAAGTTTTTGGCCGGGTGCGG - Intergenic
1175405690 20:58725185-58725207 TTAAAGAATCCGGCCAGGTGCGG + Intergenic
1176341393 21:5699795-5699817 TTTAATTATCTTGCCATGTGGGG - Intergenic
1176473647 21:7131948-7131970 TTTAATTATCTTGCCATGTGGGG - Intergenic
1176503434 21:7624661-7624683 TTTAATTATCTTGCCATGTGGGG + Intergenic
1176608344 21:8852224-8852246 CCAAATTATCTGGCCATTTGTGG + Intergenic
1176947312 21:14998429-14998451 ATTGAGTCTCTTGCCATGTGGGG - Intronic
1177100708 21:16894899-16894921 ATAAAGGAACTGGGCAGGTGGGG - Intergenic
1177102762 21:16916727-16916749 ATAAAGGAACTGGGCAGGTGGGG - Intergenic
1177229460 21:18300633-18300655 TTAATGTATCTGGCCAGGTGTGG - Intronic
1177689208 21:24482091-24482113 TTAAAGTATCTGAAAATGTGAGG - Intergenic
1178862062 21:36297822-36297844 AAAAAATATCAGGCCATCTGTGG - Intergenic
1179361899 21:40717556-40717578 ATACAGTATGTGGCCTTTTGTGG - Intronic
1179681409 21:43023902-43023924 AAAAAAAATCTGGCCAGGTGTGG - Intronic
1180358429 22:11862029-11862051 CCAAATTATCTGGCCATTTGTGG + Intergenic
1180379833 22:12130301-12130323 CCAAATTATCTGGCCATTTGTGG - Intergenic
1180828932 22:18887771-18887793 ATAAAAAATCCGGCCAGGTGTGG + Intergenic
1180897695 22:19349072-19349094 ATCAAGTATCAGGCCAGGCGTGG - Intronic
1181538311 22:23558741-23558763 AAAAGGTATCTGGCCAGGTGTGG + Intergenic
1182046288 22:27276672-27276694 AAGAAATATCTGGCCAGGTGTGG - Intergenic
1182136643 22:27910384-27910406 ATAATGTTTCTGGCCAGGTGTGG - Intronic
1182506777 22:30789001-30789023 ATAAATTGTTTGGCCAGGTGTGG - Intronic
1182733854 22:32516654-32516676 AAAAGGTATCAGGCCAGGTGTGG - Intronic
1183570437 22:38649272-38649294 AAAATGTATCTGGCCAGATGCGG + Intronic
1184123780 22:42472236-42472258 AGATAGTATCTGGCCAGGTGCGG - Intergenic
1184167752 22:42740424-42740446 ATAAAGAATCTGTTCAGGTGTGG + Intergenic
1185112344 22:48907354-48907376 ATAAAGTTTCTGGACAGGCGAGG - Intergenic
950220074 3:11188309-11188331 ATAAAGAATCAGGCCAGGTGAGG + Intronic
950781510 3:15396858-15396880 GAGAAGTACCTGGCCATGTGAGG + Intronic
951316235 3:21192171-21192193 ATAAGGGAACTGGCCAGGTGGGG + Intergenic
951592385 3:24280334-24280356 TTGGAGTACCTGGCCATGTGAGG - Intronic
952396690 3:32927251-32927273 TTAAAGCATTTGGCCAGGTGTGG - Intergenic
952442448 3:33345934-33345956 ATTGAGAATCTGGCCAGGTGTGG + Intronic
952846523 3:37692203-37692225 ATAAAGTATAAGCTCATGTGTGG - Intronic
953586479 3:44205841-44205863 ATAAAGTGTAGGACCATGTGGGG - Intergenic
953831699 3:46303155-46303177 AATAAGTTTCTGGCCAGGTGTGG - Intergenic
954157145 3:48692121-48692143 AGAAAGTTTCTGGCCGGGTGCGG - Intronic
954254151 3:49392116-49392138 ATAAATTAATTGGCCATGTGTGG - Intronic
954300110 3:49696625-49696647 AAAAAGTATGTGGCCAGGTGCGG - Intronic
955246925 3:57233784-57233806 AAAAAATTTTTGGCCATGTGTGG + Intronic
955310260 3:57879788-57879810 AAAAATTAGCTGGGCATGTGTGG + Intronic
957569070 3:81922854-81922876 ATAAAGCATCCAGCCAAGTGAGG + Intergenic
957967936 3:87345734-87345756 TTGGAGTACCTGGCCATGTGAGG + Intergenic
958809534 3:98844651-98844673 ATAATGAATGTGGCCAGGTGCGG - Intronic
959295027 3:104524190-104524212 TAAAAATATCTGGCCAGGTGCGG + Intergenic
960839024 3:121938009-121938031 TTGGAGTACCTGGCCATGTGAGG + Intronic
961881126 3:130062003-130062025 ATAAGGGAACTGGGCATGTGGGG - Intergenic
961908715 3:130290793-130290815 ATAAAAAATCAGGCCAGGTGTGG - Intergenic
963178843 3:142332061-142332083 ATAATATAACTGGCCAGGTGTGG - Intronic
963926219 3:150953806-150953828 ATAAAGTACTTGGCCGGGTGTGG - Intronic
967059422 3:185858827-185858849 ATACAATATATGGCCAGGTGCGG + Intergenic
967431512 3:189391417-189391439 AAAAGATATCTGGCCAGGTGTGG - Intergenic
967793180 3:193570985-193571007 AATAAGTATCTGGCCAGGTGTGG + Intronic
968144918 3:196289895-196289917 ATAAAATTACTGGCCAGGTGTGG + Intronic
968163577 3:196446653-196446675 AATAAGTATGTGGCCAGGTGAGG + Intergenic
968715066 4:2151478-2151500 AAAAAGTATCTATCCATGTAAGG + Intronic
969273660 4:6119905-6119927 TAAAACTATCAGGCCATGTGGGG - Intronic
970307011 4:14743630-14743652 ATAAAATTTCTTGCCATGTCAGG - Intergenic
970364289 4:15342423-15342445 ATAAAGTATCTGGCACAGAGTGG - Intronic
970712945 4:18885513-18885535 ATAAAATATGTGGCCATGGCAGG + Intergenic
970853970 4:20633268-20633290 ATAAAGGAACTGGGCAGGTGGGG + Intergenic
971121978 4:23714691-23714713 AAAAAGTAGCTGGGCATGTTGGG - Intergenic
971552740 4:27976703-27976725 ATAAGGTAGCTGGGCATGTGGGG - Intergenic
972478270 4:39473972-39473994 ATAAATTGGCTGGCCAGGTGGGG + Intronic
972876773 4:43371916-43371938 AGAAGGTAGATGGCCATGTGGGG + Intergenic
973242428 4:47970863-47970885 ATACAGTATGAGGCCAAGTGTGG + Intronic
973843078 4:54882179-54882201 GAAAAGAATCTGGCTATGTGAGG - Intergenic
973872431 4:55179799-55179821 ATAAAGTATCTGGCTGGGCGCGG - Intergenic
974235889 4:59180475-59180497 ATGAAGATTCTGGCCAAGTGCGG + Intergenic
974299356 4:60043012-60043034 ATAAAGTGTCTGTGCATTTGGGG - Intergenic
975174867 4:71276755-71276777 ATAAAGCTGCTGGCCAGGTGTGG + Intronic
975572081 4:75828051-75828073 AGAAATTATCTGGCCAGGTGCGG + Intergenic
976180775 4:82396735-82396757 ATAAAGAATGTGGCCGGGTGCGG + Intergenic
976319426 4:83696159-83696181 TTAAAATATCTGGCCAGGAGCGG + Intergenic
976401566 4:84612698-84612720 ATTAAAGATCTGGCCAGGTGCGG + Intronic
977603609 4:98960215-98960237 AAAAATAATCTGGCCAGGTGCGG + Intergenic
977910696 4:102532336-102532358 ATAAATTCTCTGGCCGGGTGAGG + Intronic
978185010 4:105846947-105846969 ATAAAGAACATGGCCAGGTGAGG - Exonic
978315694 4:107434047-107434069 ATAAAGTAACTGCCCCTATGAGG - Intergenic
978591202 4:110327184-110327206 GAGGAGTATCTGGCCATGTGAGG + Intergenic
980285024 4:130770096-130770118 ATAAAGGAACTGGGCAGGTGGGG - Intergenic
981926560 4:150146991-150147013 ATACTGTATGTGGCCAAGTGTGG + Intronic
982361178 4:154520701-154520723 ATTAGGTATTTGGCCAGGTGCGG - Intergenic
982652163 4:158099661-158099683 ACAAAGGACCGGGCCATGTGGGG - Intergenic
983181080 4:164649813-164649835 AAGGAGTACCTGGCCATGTGAGG - Intergenic
984299340 4:177894872-177894894 ACACAGTATCTGGCCAGGTGCGG - Intronic
984766634 4:183405066-183405088 ATGAAGTTGCTGGCCAGGTGCGG + Intergenic
985235335 4:187866769-187866791 AAAAAGTAACTGGCCGGGTGTGG - Intergenic
1202770904 4_GL000008v2_random:206318-206340 CCAAATTATCTGGCCATTTGTGG - Intergenic
986979877 5:13435143-13435165 ATCAAGGATCTGGCCAACTGCGG - Intergenic
987172438 5:15272162-15272184 TTGGAGTACCTGGCCATGTGAGG - Intergenic
987361692 5:17112890-17112912 AAAAAGTATCTGGCAGAGTGTGG + Intronic
987608138 5:20166148-20166170 ATAAAAGCTCTGGCCAGGTGTGG + Intronic
987921052 5:24282625-24282647 TTAAAGAATCTGGCCAGGCGCGG + Intergenic
988382355 5:30514253-30514275 ATAAAGTATCAGGCCATTATGGG + Intergenic
988445919 5:31285954-31285976 ATAAATTATCTGGCAATTTCAGG + Intronic
991052994 5:62292291-62292313 GAGAAGTACCTGGCCATGTGTGG - Intergenic
991235094 5:64384696-64384718 AAGAAGTATATGGCAATGTGTGG + Intergenic
991861245 5:71015084-71015106 AGAAAGTAAGTGGCCAAGTGTGG + Intronic
991916651 5:71612092-71612114 ATAAAGTATTTGACCAGGCGCGG - Intronic
992040256 5:72823806-72823828 TTAAGGTTTGTGGCCATGTGTGG - Intronic
992223842 5:74599349-74599371 ATTAAGTATTGGGCCAGGTGTGG + Intergenic
992735738 5:79718175-79718197 ATAAAATAGCTGGCCGGGTGCGG - Intronic
993260094 5:85647059-85647081 ATAATGTATCTGCTCTTGTGAGG + Intergenic
993384562 5:87249212-87249234 AAAAAGAATCTAGCCAGGTGTGG - Intergenic
993928822 5:93910247-93910269 ATAAAGTATATTTCCATGGGGGG + Intronic
994201166 5:96978077-96978099 ATAAAGTATCTTCCCTTGTAGGG + Intronic
996161175 5:120167232-120167254 ATAAAGTATGTGGTAATGTCTGG - Intergenic
997146544 5:131440445-131440467 ATAAAGTAAGTGGCCAGGTATGG + Intronic
997489765 5:134263864-134263886 ATTAAGTTTCTGTACATGTGTGG - Intergenic
998300803 5:141017787-141017809 AGAAAGTATGTGGCCGGGTGCGG - Intergenic
998536839 5:142940784-142940806 TTAAAGAATTTGGCCAGGTGCGG + Intronic
999760781 5:154699375-154699397 ATAAAGCATTAGGCCAGGTGTGG + Intergenic
999803805 5:155062948-155062970 ATAAAGAATCTCGCCAGGCGCGG - Intergenic
1000724436 5:164751955-164751977 AGAAAGCATCTGGCTAGGTGTGG - Intergenic
1001140068 5:169137010-169137032 ACAAAGAAACTGGCCAGGTGTGG - Intronic
1001864540 5:175092037-175092059 ATCAAGTCTATGGCCAGGTGTGG - Intergenic
1002385683 5:178864911-178864933 AAAATGTTTCTGGCCAGGTGTGG - Intronic
1002607820 5:180393774-180393796 ATAAAGCATCTGCCCATGGCAGG + Intergenic
1003081679 6:3026393-3026415 AGAAAGAATCTGCCCTTGTGGGG + Intergenic
1003148558 6:3529453-3529475 ATAAAGGATCTGGCAAACTGTGG - Intergenic
1003276026 6:4653851-4653873 AGAAAATTTCTGGCCAGGTGTGG - Intergenic
1003492670 6:6637299-6637321 AAACAGTATGTGGCCAGGTGCGG - Intronic
1004148724 6:13094169-13094191 AAAAAATAGCTGGCCATGTGTGG - Intronic
1004624801 6:17364685-17364707 AAAAATTAGCTGGGCATGTGTGG - Intergenic
1006762278 6:36473480-36473502 ATAAATTAACTGGCCAGGCGTGG + Intronic
1006883125 6:37356610-37356632 ATAAAGTATCTAGGCCTTTGGGG + Intronic
1007124575 6:39414896-39414918 AAAAAAAATCTGGCCAGGTGTGG + Intronic
1008490943 6:52086399-52086421 ATAAATTAAATGGCCAGGTGTGG - Intronic
1008623378 6:53293709-53293731 ATAAAGCATATGTCCACGTGGGG + Intronic
1008830049 6:55747826-55747848 AAAAGGAATCTGGCCATGTGAGG - Intergenic
1008968171 6:57335609-57335631 TTGGAGTACCTGGCCATGTGAGG - Intronic
1010646443 6:78394496-78394518 ATATTGTATCTAGCCATATGAGG - Intergenic
1010854480 6:80820979-80821001 TTGGAGTACCTGGCCATGTGAGG - Intergenic
1011135426 6:84094845-84094867 AAAAATTATCTGGCCAGGTGCGG - Intergenic
1011642349 6:89427562-89427584 ATACAGTATGTGGCCTTTTGAGG - Intergenic
1011726433 6:90214912-90214934 AAAAATTATCTGGGCATGGGTGG - Intronic
1013008942 6:106102656-106102678 ATAAAGTTTCAGTCCATCTGTGG - Intronic
1013560915 6:111304008-111304030 TAAAAATATCTGGCCAGGTGTGG - Intronic
1013923337 6:115437471-115437493 ATAATGTGTTTGGCAATGTGGGG + Intergenic
1014045731 6:116883693-116883715 ATAAAGCCACTGGCCATATGTGG - Intronic
1014328289 6:120027633-120027655 AGAAAATACCTGGCCAGGTGCGG + Intergenic
1014760800 6:125354914-125354936 ATAAAGAAGCTGTCCAAGTGAGG - Intergenic
1015343507 6:132129499-132129521 ATGAATTTTCTGGCCAGGTGCGG + Intergenic
1015625302 6:135175451-135175473 AGAAAAGTTCTGGCCATGTGTGG - Intergenic
1016688266 6:146905822-146905844 ATAAAGTATCAGGCCTTCAGTGG + Intergenic
1016830430 6:148428336-148428358 ATAAACTATCAGGCCGGGTGCGG + Intronic
1016853357 6:148642536-148642558 ATAAAGGAACTGGGCAGGTGGGG - Intergenic
1017013124 6:150078134-150078156 AAGAATTATCTGGCCAGGTGTGG - Intergenic
1017129725 6:151097882-151097904 ATAAAATATTAGGCCAGGTGTGG + Intronic
1017542500 6:155417039-155417061 ATAATGTTTCAGGCCAGGTGTGG - Intronic
1017779258 6:157703630-157703652 ATAAGGTAACTGGGCAGGTGGGG + Intronic
1018454890 6:163943170-163943192 AAAAAATATCTGGCCAGGTACGG + Intergenic
1019257176 7:59885-59907 ATAAATTAGCTGCCCCTGTGTGG - Intergenic
1020003689 7:4770242-4770264 ATCAAATATTTGGCCAGGTGCGG + Exonic
1020170921 7:5844424-5844446 AAAAAGTTCCTGGCCAGGTGCGG - Intergenic
1020998698 7:15299533-15299555 ATATATTATATGGCCAGGTGCGG + Intronic
1021100316 7:16581092-16581114 ATAAAGTATCTGAACATATTTGG - Intronic
1021186455 7:17570910-17570932 AGAGGGTACCTGGCCATGTGAGG + Intergenic
1021302534 7:18990292-18990314 TTGGAGTACCTGGCCATGTGAGG + Intronic
1022073414 7:26940646-26940668 ATAAAATATGTTTCCATGTGAGG - Intronic
1023417297 7:39945654-39945676 AAAAAATATTTGGCCAGGTGCGG + Intergenic
1023438103 7:40159208-40159230 AGAAATTATCTGGCCAGGCGTGG - Intronic
1023919888 7:44620309-44620331 ATAAAAAATCTGGCCAGGAGCGG - Intronic
1026022658 7:66721858-66721880 AGAAAGTTTTTGGCCAAGTGGGG + Intronic
1026887062 7:73956848-73956870 ACAAAGTTTTTGGCCAGGTGGGG + Intergenic
1026977913 7:74509826-74509848 AAAAATTATCTGGCCACGTGTGG - Intronic
1027450354 7:78324668-78324690 ATAATGAATCTGCCCAGGTGCGG + Intronic
1027965110 7:84994150-84994172 TTAAAGTTTCTGGCCGGGTGCGG - Intergenic
1028803551 7:94997092-94997114 ACAGAGTATCTGGCCAGGTGTGG - Intronic
1028923341 7:96330759-96330781 ATAAAGAGACTGGCCAGGTGCGG + Intergenic
1029173870 7:98650053-98650075 AGAAAGAATCTGGCCAGGCGCGG + Intergenic
1029219277 7:98975098-98975120 GTGAAGTGTGTGGCCATGTGAGG + Intronic
1029582275 7:101445129-101445151 ATAAAGTACCTGGCCAGGCATGG - Intronic
1029624927 7:101714701-101714723 ATAAAATCTTTGGCCAGGTGTGG + Intergenic
1030163532 7:106531420-106531442 ATAAGGGAGCTGGGCATGTGGGG + Intergenic
1033354044 7:140585222-140585244 TTAAAGTATTTTGCCATTTGTGG - Intronic
1033721563 7:144064356-144064378 AAAAAAAATCTGGCCATGTATGG + Intergenic
1036000777 8:4601244-4601266 AAAAAAAATCTGGCCAGGTGCGG - Intronic
1036038737 8:5049386-5049408 ATGAAATTTCTAGCCATGTGTGG - Intergenic
1037593862 8:20337421-20337443 AGAAACTATCTGGCCAGGTGTGG + Intergenic
1037970333 8:23167293-23167315 AAAAAACATCTGGCCGTGTGCGG + Intergenic
1038184529 8:25260949-25260971 ATAAAATAACTAGCCAGGTGAGG - Intronic
1038968884 8:32608833-32608855 ATGAAGAATATGGCCACGTGGGG - Intronic
1040092960 8:43417587-43417609 TTGAAGTATCCGGCCATGTGAGG + Intergenic
1040492409 8:47936961-47936983 ATACAGTATCTGGCCGGGTGCGG + Intronic
1040612435 8:48998364-48998386 GAGGAGTATCTGGCCATGTGAGG - Intergenic
1040727848 8:50404898-50404920 ATACAATATCTGACCATTTGTGG + Intronic
1040845071 8:51829399-51829421 AAAAAGCAGCTGGCCATGTTTGG + Intronic
1041230490 8:55746022-55746044 TTAAAGAATTTGGCCAGGTGCGG + Intronic
1041250289 8:55927542-55927564 ATAAAGCTGCTGGCCAGGTGCGG + Intronic
1042694232 8:71538951-71538973 ATAAAGGATTTGGCCATTTAGGG - Intronic
1043445891 8:80318857-80318879 ATAATTTATCTGGCCAGGTACGG - Intergenic
1043455595 8:80408972-80408994 ATACAGTATTTGGCCAGGAGCGG + Intergenic
1044134382 8:88567244-88567266 AAACAGTATCTGGCCCTTTGTGG - Intergenic
1044242147 8:89901030-89901052 ATAAAGTACCTGGCCGGGCGCGG - Intergenic
1044286404 8:90415867-90415889 GTAAAGTCTCTGGCCGGGTGTGG + Intergenic
1044995783 8:97836829-97836851 AAAAAGTATTTTGCTATGTGGGG + Intronic
1045278497 8:100728209-100728231 ATAAAGTATTTGGCCAGGCACGG + Intergenic
1046296955 8:112232156-112232178 ATATAGTATGTGGCCTTTTGTGG - Intronic
1046514840 8:115245200-115245222 ATGAACTATCTGGGCATGTCTGG + Intergenic
1046879557 8:119292796-119292818 GAAGAGTAACTGGCCATGTGAGG - Intergenic
1046948461 8:119997524-119997546 ATAAATAATCTGGACAGGTGTGG - Intronic
1047481425 8:125287039-125287061 ATACAGAATTTGGCCAGGTGTGG + Intronic
1049532922 8:143165138-143165160 AAAAAGTACCTGGCCAGGCGCGG + Intergenic
1049623814 8:143611297-143611319 ATAAAGGCTCTGCCCATGTGGGG - Intergenic
1049813008 8:144584470-144584492 ATTGAGTTTCTGGCCAGGTGCGG + Intronic
1049915004 9:308945-308967 AGAAAGAACCTGGCCAGGTGCGG - Intronic
1049978750 9:884678-884700 TTAAAACATCTGGCCAGGTGCGG + Intronic
1050140557 9:2512165-2512187 ATAAAGGAACTGGGCAGGTGGGG - Intergenic
1050720504 9:8583473-8583495 ATAAATTATCCAGCCATGCGTGG - Intronic
1051537727 9:18178774-18178796 TTGGAGTACCTGGCCATGTGAGG - Intergenic
1051727570 9:20103468-20103490 AAGGAGTACCTGGCCATGTGAGG - Intergenic
1051861148 9:21626469-21626491 ATAAAACATCTGGGGATGTGGGG + Intergenic
1052301124 9:26953798-26953820 ATAAATTTTTTGGCCAGGTGTGG - Intronic
1052922121 9:33979590-33979612 AAAAAATAACTGGCCAGGTGCGG + Intronic
1052957976 9:34269707-34269729 ATAAAGCTTCTGGCCAGGCGCGG - Intronic
1053028201 9:34749440-34749462 ATAAAGGATCCAGCCAGGTGTGG + Intergenic
1053926206 9:43060783-43060805 TTAAAATATGTGACCATGTGTGG + Intergenic
1054289500 9:63270192-63270214 TTAAAATATGTGACCATGTGTGG + Intergenic
1054836330 9:69677781-69677803 AAAAAAAATCTGGCCAGGTGCGG - Intergenic
1055087214 9:72326455-72326477 AAAAAGTATGCGGCCAGGTGTGG - Intergenic
1055962081 9:81830236-81830258 AAAAAGTCTCTTGCCAGGTGTGG - Intergenic
1056019235 9:82424134-82424156 ATAAAGTATCTGTCAAGGTATGG - Intergenic
1056428797 9:86506285-86506307 AGGAAGTACGTGGCCATGTGCGG + Intergenic
1058804902 9:108581413-108581435 AAAAATTATCTGACCATGGGAGG + Intergenic
1058928908 9:109698838-109698860 ATATAGTATCTAGCCTTGAGGGG + Intronic
1060185146 9:121559651-121559673 ATAAAATATTTGGCCGGGTGTGG - Intergenic
1060893790 9:127204699-127204721 ATGCAGTTTCTGCCCATGTGAGG + Intronic
1061583154 9:131549815-131549837 ATAAGGGAACTGGGCATGTGGGG - Intergenic
1061978645 9:134087074-134087096 AAAAAGTATCTGGCCGGGCGTGG + Intergenic
1062505410 9:136872227-136872249 AAAAAGAAACTGGCCAGGTGTGG + Intronic
1062663266 9:137651491-137651513 ATAATGGAGCTGGCCAGGTGCGG + Intronic
1203703744 Un_KI270742v1:17437-17459 CCAAATTATCTGGCCATTTGTGG + Intergenic
1185751968 X:2618633-2618655 ATAAAGTATTTAGTCACGTGGGG + Intergenic
1186366010 X:8894060-8894082 AAAAAGTATCAGGCTGTGTGAGG + Intergenic
1186822484 X:13304606-13304628 ATAAAGAATTTGGCCAGGTATGG - Intergenic
1187415388 X:19088758-19088780 ATACAATATCAGGCCAGGTGTGG - Intronic
1188011893 X:25065300-25065322 ATTCAGTATTTGGCAATGTGAGG - Intergenic
1188184773 X:27100337-27100359 ATAAAATATCTGGCAGGGTGTGG - Intergenic
1189463784 X:41262947-41262969 AGAAATTCTCTGGCCAGGTGAGG - Intergenic
1190689737 X:52903506-52903528 ATACAGTTTGTGGCCTTGTGAGG + Intronic
1190696246 X:52952286-52952308 ATACAGTTTGTGGCCTTGTGAGG - Intronic
1191183814 X:57589313-57589335 ATCAAGTATCTACCCATATGTGG - Intergenic
1192093792 X:68188546-68188568 ATAAAGTATCTTGATATGTATGG + Intronic
1192480458 X:71480831-71480853 ATAAATTATGTGGCTATCTGGGG + Intronic
1192918972 X:75685762-75685784 AAAGAGTACCTGGCCGTGTGAGG + Intergenic
1193537164 X:82729555-82729577 ATAAAGGAGCTGGGCAGGTGGGG - Intergenic
1193540565 X:82766807-82766829 ATAAAATAATTGGCCAGGTGTGG - Intergenic
1193639620 X:83995948-83995970 GTAAAGTATCTGGCCAGGAATGG - Intergenic
1194026878 X:88763947-88763969 AAAAAGATTATGGCCATGTGTGG + Intergenic
1194190376 X:90828014-90828036 ATAAACTAGCTAGCAATGTGTGG - Intergenic
1194545810 X:95232021-95232043 ATAAAGTACCTGGCCCTGTCTGG - Intergenic
1194757751 X:97757938-97757960 ATTGGGTATCTGGCCAGGTGCGG + Intergenic
1194775914 X:97964069-97964091 ATGAAGTATTTGCCCATGTATGG + Intergenic
1195611956 X:106877578-106877600 ATAAAGTAAGTGGCCATTTTGGG - Intronic
1198509750 X:137338312-137338334 AGAAAGTATCTGGCCGGGAGTGG - Intergenic
1198550159 X:137736719-137736741 ATGAAGTCTCAGGCCAGGTGTGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200537031 Y:4410434-4410456 ATAAACTAGCTAGCAATGTGTGG - Intergenic
1200779935 Y:7205596-7205618 TTAAAGTATCATCCCATGTGTGG + Intergenic
1201781492 Y:17728007-17728029 ATAAAAGATCTGGCAAAGTGTGG + Intergenic
1201820061 Y:18177983-18178005 ATAAAAGATCTGGCAAAGTGTGG - Intergenic
1201860193 Y:18589164-18589186 AAAAAACACCTGGCCATGTGTGG + Intergenic
1201873128 Y:18731217-18731239 AAAAAACACCTGGCCATGTGTGG - Intergenic
1202166674 Y:21996394-21996416 AAAAATAACCTGGCCATGTGTGG - Intergenic
1202224685 Y:22589979-22590001 AAAAATAACCTGGCCATGTGTGG + Intergenic
1202318429 Y:23605681-23605703 AAAAATAACCTGGCCATGTGTGG - Intergenic
1202552338 Y:26064376-26064398 AAAAATAACCTGGCCATGTGTGG + Intergenic