ID: 1107924248

View in Genome Browser
Species Human (GRCh38)
Location 13:45243193-45243215
Sequence TAAAGTACACAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107924248_1107924260 28 Left 1107924248 13:45243193-45243215 CCTCCATCCTTCTGTGTACTTTA 0: 1
1: 0
2: 2
3: 27
4: 289
Right 1107924260 13:45243244-45243266 CATACTGGTCCGTGCCTGTTAGG 0: 1
1: 0
2: 2
3: 5
4: 55
1107924248_1107924255 2 Left 1107924248 13:45243193-45243215 CCTCCATCCTTCTGTGTACTTTA 0: 1
1: 0
2: 2
3: 27
4: 289
Right 1107924255 13:45243218-45243240 TCAGGGGTTCCTCAACGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1107924248_1107924254 1 Left 1107924248 13:45243193-45243215 CCTCCATCCTTCTGTGTACTTTA 0: 1
1: 0
2: 2
3: 27
4: 289
Right 1107924254 13:45243217-45243239 ATCAGGGGTTCCTCAACGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 114
1107924248_1107924257 13 Left 1107924248 13:45243193-45243215 CCTCCATCCTTCTGTGTACTTTA 0: 1
1: 0
2: 2
3: 27
4: 289
Right 1107924257 13:45243229-45243251 TCAACGCCTGGGCCGCATACTGG 0: 1
1: 0
2: 1
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107924248 Original CRISPR TAAAGTACACAGAAGGATGG AGG (reversed) Intronic
900497733 1:2983802-2983824 TACAGTGCACAAAGGGATGGTGG - Intergenic
900697059 1:4019081-4019103 TCCAGGACACAGCAGGATGGCGG - Intergenic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
904841652 1:33375850-33375872 TAAAGTATATAGGAGGATGTGGG + Intronic
907988580 1:59556946-59556968 CCAAGTACAAAGCAGGATGGGGG - Intronic
908171939 1:61513409-61513431 TAAAGTAGAGAGTAGAATGGTGG - Intergenic
908491623 1:64650079-64650101 TAAAGTACAGAGAGTGATTGAGG + Intronic
908745754 1:67375096-67375118 AAAAGTACACAAAAGGAGGCTGG + Intronic
909167865 1:72251557-72251579 TGAAGTACATGGAAGGATGAGGG - Intronic
909879518 1:80855966-80855988 TAAAATACACATAAGAAAGGAGG + Intergenic
910946807 1:92601662-92601684 AAAAGTACAGAGTAGAATGGTGG + Intronic
911294418 1:96097162-96097184 TAAACTAAACAGATGGATGTGGG + Intergenic
917633431 1:176912709-176912731 TAAGGAACACAGGGGGATGGTGG + Intronic
917761562 1:178165044-178165066 TAAAGTATACAGGAAGATGTAGG + Intronic
922061943 1:222101282-222101304 TGCACTACACAGGAGGATGGGGG - Intergenic
1063327441 10:5118477-5118499 TAATTTACACAGAAAGGTGGAGG + Intronic
1063757983 10:9037747-9037769 TACAGTACAAAGAATGATAGAGG + Intergenic
1063975924 10:11415505-11415527 TAAAGTCCACAGAAGTGTGGGGG - Intergenic
1064196857 10:13250706-13250728 TAAAGCAGAAAGAAGGATGAAGG + Intergenic
1064984273 10:21194263-21194285 TAAAATACACTTAAGGCTGGGGG - Intergenic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1066219694 10:33323197-33323219 TTTAAAACACAGAAGGATGGGGG - Intronic
1066238267 10:33507957-33507979 TAAAAGACAGAGAAGGAGGGAGG - Intergenic
1066311694 10:34203529-34203551 TAAAGTATACAGGAGGATGTGGG - Intronic
1066818517 10:39453583-39453605 AAAACTACACAGAAGGATTATGG - Intergenic
1069576824 10:69536626-69536648 AAAAGGACACAGCAAGATGGTGG - Intergenic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1076736674 10:132462166-132462188 TAAATTACACAGAAGGTGGTTGG + Intergenic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1078292584 11:10027804-10027826 TAAAGTCCTCAGATAGATGGTGG + Intronic
1080812198 11:35715913-35715935 TACAGTACCAAGAGGGATGGTGG + Intronic
1082138692 11:48580723-48580745 TAAATTACACTGAAGGAAGCAGG - Intergenic
1082315847 11:50720057-50720079 TAAAGTACACAGAGGCATTCTGG - Intergenic
1082318499 11:50763351-50763373 AAAACTACACAGAAGCATTGTGG - Intergenic
1083388270 11:62328810-62328832 TAAAGTACACAGAGGGGAGAGGG + Intergenic
1083966860 11:66048720-66048742 TAATGGAGACAGGAGGATGGAGG - Intronic
1084656700 11:70523863-70523885 TGAAGGACACAGCAGGATGAAGG - Intronic
1085874329 11:80387825-80387847 TAAAGCATATAGAAGGATGCAGG - Intergenic
1087916035 11:103811983-103812005 TAAAGCACAAAGTAGGAGGGTGG + Intergenic
1088080732 11:105908947-105908969 TTAAGTACACATAAGAATTGAGG + Intronic
1088289892 11:108224567-108224589 TAAAGAACACAGTATGTTGGCGG - Intronic
1089830865 11:121326733-121326755 TAAAGTCCCATGAAGGATGGTGG - Intergenic
1090085506 11:123646784-123646806 TACAGTACGCAGGAGGAAGGAGG + Intronic
1090975956 11:131680134-131680156 TAAATACCAGAGAAGGATGGGGG - Intronic
1091191515 11:133699386-133699408 TAAAGTACTCATAAGCATTGAGG + Intergenic
1091382851 12:73884-73906 TACAGATCACAGAGGGATGGTGG - Intronic
1094099502 12:26746088-26746110 TAAATTACCCAGAAGAATAGGGG + Intronic
1094318282 12:29156037-29156059 AAAAGTAGAGAGAAGAATGGTGG + Intronic
1094740826 12:33286686-33286708 AAAAGTACCCAAAAGGATAGTGG + Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096638350 12:52975475-52975497 GAATGCAGACAGAAGGATGGAGG - Intergenic
1097120689 12:56729306-56729328 TAAAGAACTCAGAAGGAGAGTGG - Intronic
1097861147 12:64519948-64519970 TCACGTACACAGAAGGCAGGGGG - Intergenic
1098281804 12:68869632-68869654 TAAAGTAGAAAGAAGAATAGAGG - Intronic
1098367134 12:69715896-69715918 AATAGTACAAAGGAGGATGGCGG + Intergenic
1101521896 12:105491484-105491506 AGAAGTATACAGAAGAATGGTGG - Intergenic
1102507806 12:113394832-113394854 TGAAGGACACAGCAGGATGTGGG - Intronic
1107465682 13:40647736-40647758 CAAAGAACCTAGAAGGATGGGGG + Intronic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1107939762 13:45373212-45373234 TTATGTACACAGAAGAATGAAGG - Intergenic
1108130350 13:47292796-47292818 GAAAGGAGACAGAAGGAAGGAGG + Intergenic
1109119482 13:58436034-58436056 AAAAGCACAAAGAAGGAAGGAGG - Intergenic
1109418296 13:62073761-62073783 TAAAGTAGAGAGTAGAATGGCGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114619564 14:24087158-24087180 TAAAGGAGACAGAAAGATGTAGG + Intronic
1115590668 14:34861672-34861694 TAAATTAAAGAGAAGGAAGGTGG + Intronic
1116664340 14:47755659-47755681 GGAATTACACAGAAGGAGGGAGG + Intergenic
1116883883 14:50199613-50199635 TAATGTACACAAAAAGATTGAGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1120067861 14:80065658-80065680 AAAAGTAGACAGTAGAATGGTGG + Intergenic
1121770512 14:96531598-96531620 TGAAGTACACAAAAGGAAGTAGG - Intronic
1202918717 14_KI270723v1_random:10780-10802 AGAAGTAGACAGTAGGATGGTGG + Intergenic
1202925907 14_KI270724v1_random:23790-23812 AGAAGTAGACAGTAGGATGGTGG - Intergenic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1128775239 15:70315509-70315531 AAGAGGACACAGAAGGATGTAGG - Intergenic
1130790739 15:87153276-87153298 TAAAGTAAAAAGAAAGATCGAGG - Intergenic
1131536824 15:93244690-93244712 GAAAGTACAGCGCAGGATGGTGG - Intergenic
1131820843 15:96272056-96272078 TGAAGTACACAGAATCATGTCGG + Intergenic
1131837154 15:96402267-96402289 AAAAGAACACAGAAAGAGGGAGG + Intergenic
1132205023 15:99980536-99980558 GAAACTGCACAGATGGATGGAGG + Intronic
1132334979 15:101042516-101042538 TAAAAGCCACAGGAGGATGGTGG - Intronic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1133636872 16:7675139-7675161 TAAAGTTCACAGAAAGATACAGG - Intronic
1133892827 16:9897054-9897076 ATAAGTACACAGAAGCATGCTGG + Intronic
1138472361 16:57247899-57247921 TAAAATGGACTGAAGGATGGTGG + Intronic
1139271462 16:65687326-65687348 TAAAGAATACAGAAGGAGAGGGG + Intergenic
1140681641 16:77390993-77391015 TAGAGTAGATGGAAGGATGGTGG - Intronic
1140970427 16:80007238-80007260 AAAGGTAGAGAGAAGGATGGTGG - Intergenic
1141110261 16:81265979-81266001 GATAGTAGACAGATGGATGGTGG - Intronic
1141130788 16:81435124-81435146 TAAAGTACAGAGAAGGTCCGTGG + Intergenic
1142392128 16:89808410-89808432 TAAAGGACTCAGAATGCTGGGGG - Intronic
1143707294 17:8707727-8707749 TTAAGTGCACAGAAGGTTAGAGG + Intergenic
1143806519 17:9432803-9432825 GAAAGTACACAGAAGGTTAGAGG - Intronic
1143815433 17:9508658-9508680 GAAATAACACAGAAAGATGGGGG + Intronic
1145925860 17:28646000-28646022 TAAACTACACAGAAGGAAGCAGG - Intergenic
1147984449 17:44297092-44297114 TGAAGAACACAGTAGGCTGGAGG + Intergenic
1148183941 17:45627796-45627818 TAGAGTATACGGGAGGATGGGGG - Intergenic
1152286136 17:79414318-79414340 TACATTACCCAGAAGGAAGGGGG - Intronic
1203171128 17_GL000205v2_random:148610-148632 TCTAGTACCCAGAAGGAAGGGGG + Intergenic
1153445395 18:5166526-5166548 TGAAGTATATAGAAGTATGGTGG - Intronic
1154115710 18:11611523-11611545 TAAAGTATACAGGAGGATGTGGG + Intergenic
1154120154 18:11645742-11645764 TAAAGTATACAGGAGGATGTGGG + Intergenic
1154152374 18:11916336-11916358 TAAATTACAGAGAACTATGGGGG + Intergenic
1155036500 18:22029190-22029212 TCACCTACACAGTAGGATGGAGG + Intergenic
1156111686 18:33735178-33735200 TAAAGGACACAGATGGTTGCAGG + Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156668166 18:39433839-39433861 TAAAGTACACAACAGAATAGAGG - Intergenic
1156974263 18:43197978-43198000 AAAAAAACACAGTAGGATGGAGG - Intergenic
1157077466 18:44480809-44480831 CAAAGCCCAGAGAAGGATGGAGG - Intergenic
1158538931 18:58335081-58335103 GAAAGTACAAAGAAAGAGGGAGG - Intronic
1158807909 18:60997547-60997569 TAAAGTGCAGAGGAGGATGAAGG + Intergenic
1159213502 18:65361031-65361053 TACAGTACTCAGAAGCATAGAGG + Intergenic
1159930155 18:74303603-74303625 TGAAGAACAAAGAAGGTTGGAGG - Intergenic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1162678226 19:12317108-12317130 TAGAGTATACAGGAGGATGTGGG + Intergenic
1163822143 19:19502168-19502190 TAAGTTACACAGAGGGGTGGGGG - Intronic
1164348998 19:27309429-27309451 AAAACTACACAGAAGCATTGTGG + Intergenic
1164469310 19:28516045-28516067 GGAAGAACACAGCAGGATGGTGG + Intergenic
1165586251 19:36918371-36918393 TAATGTATAAAGAAGGATGTAGG - Intronic
1167284815 19:48593000-48593022 TAAACCACACAGCAGGCTGGCGG + Intronic
1167943515 19:52966793-52966815 TCAAGTACACACCATGATGGTGG + Intergenic
1168454104 19:56492029-56492051 AATAGTACAAAGAAAGATGGTGG + Intergenic
1168585688 19:57589830-57589852 TAAAGATCACAGAATGAGGGAGG - Intronic
925685061 2:6462669-6462691 AAATGTGGACAGAAGGATGGTGG - Intergenic
929991709 2:46795563-46795585 TTAAGTATACAGAAGGATGTGGG - Intergenic
931101428 2:59005892-59005914 ATAAATACCCAGAAGGATGGTGG - Intergenic
931431533 2:62212551-62212573 TCAAGCAGACAGAAGGAAGGAGG - Intronic
931631571 2:64306407-64306429 TAAAGTACCTAGAGGGAGGGAGG + Intergenic
932392452 2:71407635-71407657 AAAAGTTCACAAATGGATGGTGG - Intronic
934939162 2:98487710-98487732 TGAAGAACAAAGAAGGTTGGAGG + Intronic
935629008 2:105196718-105196740 TTAAGGACACAGGAGGCTGGGGG - Intergenic
937794535 2:126001125-126001147 TAAAGAACACAGCAAGATGCTGG + Intergenic
938042707 2:128089496-128089518 GAAAGTAGACAGAAAGATGTTGG + Intergenic
938204573 2:129408297-129408319 TAAAGCACAAAGGAGGAGGGAGG - Intergenic
939015117 2:136893682-136893704 TAAGGTACACAGAAGAAGGTGGG - Intronic
939209656 2:139157708-139157730 TAAAGTATACAGGAGGATGTGGG + Intergenic
940966656 2:159845671-159845693 TTAAGTATACAGGAGGATGTAGG + Intronic
941082167 2:161074276-161074298 TAAAGTATACAGAGGGATGTAGG - Intergenic
941496713 2:166214233-166214255 TCAAGTACAAAAAACGATGGGGG + Intronic
941797424 2:169615497-169615519 AGAAGTACAGAGAAGAATGGTGG - Intronic
942081503 2:172403490-172403512 TGAAGTAAACAGAAGGAAGCTGG + Intergenic
942797142 2:179834983-179835005 TAAGGAACAAAGAAGGCTGGGGG + Intronic
943369018 2:186992761-186992783 TAAAGTACACAGAGGAATGTCGG - Intergenic
944976077 2:205052906-205052928 TAAAGGACACAGACCGGTGGAGG + Intronic
945700142 2:213159536-213159558 TAAAGCAGGTAGAAGGATGGTGG - Intergenic
945714631 2:213343005-213343027 TGGTGTACACAGAAGGAAGGAGG + Intronic
946074939 2:217065928-217065950 TAAACTTCAGAGAAGCATGGAGG - Intergenic
948726374 2:239936494-239936516 TAAAGTAAACTGCAGGCTGGGGG + Intronic
1168819779 20:765113-765135 CAAAGAACCTAGAAGGATGGAGG + Intronic
1169404553 20:5312582-5312604 TAAAATACACAGACGGGTGTAGG - Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1170869464 20:20191754-20191776 TAAAGTGCAAAGAAGAATGCTGG - Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171737208 20:28804819-28804841 TAAACTACACAGAAGAATTCTGG - Intergenic
1171782697 20:29435476-29435498 AGAAGTAGACAGTAGGATGGTGG + Intergenic
1173152561 20:40580366-40580388 TATAGTATACAGGAGGATGCGGG + Intergenic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1175067063 20:56298065-56298087 AGAAGTACACAGAATGATTGGGG + Intergenic
1175078171 20:56393267-56393289 TAAGGTACCTGGAAGGATGGAGG - Intronic
1176282331 20:64320875-64320897 TACAGATCACAGAGGGATGGTGG + Intergenic
1176327112 21:5510440-5510462 TCTAGTACCCAGAAGGAAGGGGG + Intergenic
1176400645 21:6310511-6310533 TCTAGTACCCAGAAGGAAGGGGG - Intergenic
1176436512 21:6678593-6678615 TCTAGTACCCAGAAGGAAGGGGG + Intergenic
1176460774 21:7005663-7005685 TCTAGTACCCAGAAGGAAGGGGG + Intergenic
1176484335 21:7387441-7387463 TCTAGTACCCAGAAGGAAGGGGG + Intergenic
1177734217 21:25068833-25068855 TGAAATACACAGCAGAATGGAGG - Intergenic
1179073787 21:38098793-38098815 TAAAGTAGACAGAAAGTTTGGGG + Intronic
1179421109 21:41237551-41237573 TGAAGTACACACAAGGAAGCTGG + Exonic
1179427505 21:41293588-41293610 AAAAGTTCACAGAAGGAAGATGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182016862 22:27047721-27047743 TAAAGTAGAGACTAGGATGGTGG - Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949654753 3:6205305-6205327 TAAATTACACATTAGGATGATGG - Intergenic
952583322 3:34861503-34861525 TACAGTTAACAGAATGATGGCGG - Intergenic
952681079 3:36093906-36093928 TGAAGCACATAAAAGGATGGTGG + Intergenic
952723919 3:36561985-36562007 TAAAGCACACAGAAGGACACAGG + Intergenic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
957082780 3:75650858-75650880 AGAAGTAGACAGTAGGATGGTGG - Intergenic
958101317 3:89015134-89015156 AAAAGTGCACAGAAGGTTTGGGG + Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
959541711 3:107547638-107547660 GAAAGTACACAGAAGAGTGCCGG - Intronic
960699593 3:120427249-120427271 CAAAGTTCAGAGAAGGAAGGGGG - Intronic
962070983 3:132033932-132033954 TAAAGTAGCCAGAAGGAAAGGGG - Intronic
962249480 3:133826660-133826682 TAAAGTACATAGAGAAATGGTGG + Exonic
963513210 3:146275368-146275390 TAAAGTACAGAGAAGTTTGGGGG - Intergenic
965427269 3:168542648-168542670 TGAAGTACACAAAAGGCTGATGG + Intergenic
965639021 3:170813427-170813449 TAAATTCCAAAGAAGGAGGGAGG + Intronic
965997511 3:174902766-174902788 TAAAGTATACTCAAGGAGGGCGG + Intronic
967815696 3:193796350-193796372 TAATGTAGACAGAGGGGTGGAGG - Intergenic
969379657 4:6785787-6785809 TAAAGTACAGAGATGACTGGGGG - Intronic
970870638 4:20813090-20813112 TCATGTGCCCAGAAGGATGGAGG + Intronic
971322663 4:25617900-25617922 ACAAGAACACAGATGGATGGGGG - Intergenic
972171406 4:36350103-36350125 TTGAGTACACAGGAGGAGGGTGG - Intergenic
972556771 4:40189376-40189398 GAAAGGACTCAGAAGGGTGGAGG + Intergenic
973018142 4:45166982-45167004 TAAGTTATACAGAAGGTTGGAGG - Intergenic
974440822 4:61914700-61914722 TATACTACCCAGAAGGATAGTGG - Intronic
974476309 4:62386728-62386750 TCAAATAAGCAGAAGGATGGAGG - Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976886364 4:89989647-89989669 TAAAGTCAACAGAAGAATGTTGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977144873 4:93426033-93426055 TAAAGTACTCAGAAGGCTAGAGG + Intronic
977379212 4:96249182-96249204 TCTATTACACAGCAGGATGGTGG + Intergenic
977687475 4:99864788-99864810 CAAAGTACAAAGAAAGATGTAGG + Intronic
979213468 4:118134229-118134251 TAAAATTCAGTGAAGGATGGAGG + Intronic
981576422 4:146210655-146210677 GAAAGTGCACAGTAGCATGGAGG + Intergenic
982481458 4:155916784-155916806 TTAAATACACAGAAGCATGACGG - Intronic
983928890 4:173432202-173432224 TAAAGTAGATAGAAAGAGGGAGG - Intergenic
984930009 4:184838722-184838744 TAAAGAACAAAGCAGGTTGGGGG + Intergenic
985756140 5:1719465-1719487 TAAAGTGCCCAGAAGAAAGGAGG - Intergenic
986514447 5:8546695-8546717 TAAAGCACACAGCAGTCTGGAGG - Intergenic
986659082 5:10042878-10042900 TAAAGTACATAGGTGGATGAAGG - Intergenic
988586406 5:32511313-32511335 AAAAATACACAGAAGGATATGGG + Intergenic
990014960 5:51048965-51048987 AACAGTACACTGAAGGATGAAGG - Intergenic
990118371 5:52417718-52417740 TAGAGGACACAGGTGGATGGGGG - Intergenic
991340756 5:65606154-65606176 TGAAGTCCACCCAAGGATGGTGG + Intronic
992257064 5:74931625-74931647 TCAAGTACACACCACGATGGCGG - Intergenic
992373051 5:76164887-76164909 TAAAGTATACAGGAGGATGTGGG - Intronic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
992965509 5:81995672-81995694 TAAAGTACAGACAAAAATGGTGG + Intronic
994281320 5:97906498-97906520 TAAAGCCCACAGAAGTATGGGGG + Intergenic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
995980572 5:118098017-118098039 TAAAGTACATTGAAGGAAAGCGG + Intergenic
996302089 5:121999814-121999836 TTAAGTACACAGACATATGGAGG - Intronic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
999368151 5:151036271-151036293 TGAGGGACACAGAAGGATTGGGG - Intronic
999739402 5:154538652-154538674 TCAAGGACACTGAGGGATGGAGG - Intergenic
1000249502 5:159480595-159480617 GATAGGCCACAGAAGGATGGAGG - Intergenic
1000697472 5:164405564-164405586 AAAAGGACACAGAAGTTTGGAGG + Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1009698254 6:67139121-67139143 TAAAGTACCTAGAAGAATGCAGG + Intergenic
1010024780 6:71202399-71202421 TAATGTTCAGAGAAGGGTGGTGG + Intergenic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1011771587 6:90679227-90679249 TAAAGTACACAGAATTGTGCTGG + Intergenic
1012151187 6:95756735-95756757 TAATGTACACAGAAGCATTTTGG + Intergenic
1012260571 6:97082994-97083016 GAAAGTACACAGTAGGTTGCGGG - Intronic
1012729131 6:102858064-102858086 AATAGTACAAAGAAGGATGGAGG - Intergenic
1013832641 6:114292805-114292827 TAAAGTATACAGGAGGATATTGG - Intronic
1014074211 6:117218164-117218186 GTAAGGACACAGAAGGAAGGTGG - Intergenic
1014122342 6:117739924-117739946 TAAAAAACAAAGAAGGCTGGAGG + Intergenic
1014544659 6:122719906-122719928 AAAAATACACAGAAGGATATAGG + Intronic
1014644303 6:123954373-123954395 AGAAGTCCACAGTAGGATGGTGG + Intronic
1014689730 6:124548848-124548870 TAAAGTACACTGAGAGGTGGAGG + Intronic
1015115506 6:129644571-129644593 TAAAGGAGACAGAAGTAAGGTGG - Intronic
1015570033 6:134611433-134611455 TCAAGGACAAAGAAGCATGGAGG - Intergenic
1016657306 6:146535968-146535990 TAAAGTAAACAGATCAATGGCGG + Intergenic
1017594504 6:156014227-156014249 TAAAATACACAGAAGTAAGCAGG - Intergenic
1018278202 6:162155922-162155944 TAAAGAATGCAAAAGGATGGAGG + Intronic
1019425044 7:971014-971036 TAAAGCACGCAGCAGGATCGGGG - Intronic
1020736759 7:11959564-11959586 TCAAGAACATAGAAGGATAGAGG + Intergenic
1021681983 7:23142240-23142262 TAAAATATAGAGAAGGATGTGGG - Intronic
1021746908 7:23750163-23750185 TAAAATTCACAAAAGCATGGGGG + Intronic
1022521079 7:31007242-31007264 TAGAGAACTCACAAGGATGGGGG + Intergenic
1023294133 7:38697646-38697668 TAAAATACACAGATGAATGTGGG + Intergenic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1024221187 7:47288567-47288589 TGAAGTGCCCAGAAGGATGCAGG - Intronic
1025112361 7:56229578-56229600 TAAACTAGACAGCAAGATGGCGG + Intergenic
1025309112 7:57905212-57905234 AAAAGTACACAGAAGCATTCTGG - Intergenic
1028161800 7:87494126-87494148 TAAAGTAAACAGCAGTGTGGAGG + Intergenic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1030039746 7:105439084-105439106 GAAAGGCCACAGAAGCATGGAGG - Intergenic
1030386707 7:108875228-108875250 TAAAGTACAAAAAAGGATTGGGG - Intergenic
1031335829 7:120530450-120530472 TATACTTCAAAGAAGGATGGTGG - Intronic
1033259296 7:139828629-139828651 TAAAGTGGACAGAGAGATGGAGG - Intronic
1033535335 7:142307239-142307261 TGAAGTTCCAAGAAGGATGGTGG + Intergenic
1035114705 7:156514953-156514975 AAAAGCACACTGAAGGAAGGAGG - Intergenic
1035410253 7:158634237-158634259 TAAAGCATACAGGAGGATGTGGG - Intronic
1035416619 7:158694668-158694690 TAAAAAACACAGTAAGATGGAGG + Intronic
1035937522 8:3858249-3858271 TAAAGTCCACAGAATGAGGATGG + Intronic
1036037676 8:5037872-5037894 TAAAGTATACACAAGGATGTAGG - Intergenic
1038249466 8:25889635-25889657 GAAAGTACACAGAACAATGTGGG - Intronic
1038704060 8:29877656-29877678 TAAACTATACTGAAGGCTGGAGG + Intergenic
1041442508 8:57912201-57912223 CAAAGCACACAGAAGCTTGGGGG + Intergenic
1041684139 8:60627046-60627068 TAAAGTATACAGCAGGATGTGGG + Intergenic
1041685737 8:60642910-60642932 TAAGGTACAAAGGATGATGGTGG - Intergenic
1041865872 8:62572404-62572426 AAAAGAACACAGAAAGATGTAGG - Intronic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1043246011 8:78002250-78002272 TAAAGTCCACAGGAGTGTGGAGG - Intergenic
1043978867 8:86615097-86615119 TAAAGTATACAGGAGGATGTGGG + Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044342450 8:91062406-91062428 AAAAGTACCCCGTAGGATGGAGG - Intergenic
1044968777 8:97599516-97599538 CAAAGTTCTCACAAGGATGGAGG + Intergenic
1046050306 8:109013999-109014021 GGAAGTACTCAGAATGATGGAGG + Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1047668942 8:127123821-127123843 AAAAGTACACAGAAAAATAGAGG + Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1050617225 9:7414397-7414419 TTTAGTACACTGATGGATGGAGG - Intergenic
1050902890 9:10967771-10967793 TAAAGGACACAGATCGAAGGGGG + Intergenic
1051872266 9:21752067-21752089 TAGAGAACACTGGAGGATGGGGG + Intergenic
1053383243 9:37666489-37666511 TAAAGTGCACAGAAGGGAGATGG - Intronic
1056045924 9:82715808-82715830 AAAACTACACAGAAGGAAAGAGG - Intergenic
1058551802 9:106122889-106122911 TAAAAAACCCAAAAGGATGGGGG + Intergenic
1062670387 9:137705522-137705544 TAGAGTACACACCAGGACGGTGG - Intronic
1203435004 Un_GL000195v1:130066-130088 TCTAGTACCCAGAAGGAAGGGGG - Intergenic
1203374891 Un_KI270442v1:361370-361392 AAAACTACACAGAAGGATTCTGG + Intergenic
1187102927 X:16213389-16213411 TTAAGAACTCAGAAGGATAGAGG + Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1192103613 X:68291664-68291686 TTCAGAACACAGAAGGATGTGGG - Intronic
1192315245 X:70046086-70046108 TAAAGGAAATAAAAGGATGGGGG + Intronic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1198011148 X:132555643-132555665 AAAAGTAGACAGTAGGATAGTGG - Intergenic
1198062447 X:133060966-133060988 TAAAGTACACAGGAGGACATAGG + Intronic
1199289251 X:146088051-146088073 TAAAGAACCTAGAAGGGTGGAGG + Intergenic
1201721620 Y:17104539-17104561 AAAATTACCCAGAATGATGGTGG + Intergenic
1201855964 Y:18542513-18542535 TAAACTACACAGGAGGATGTGGG + Intergenic
1201877357 Y:18777872-18777894 TAAACTACACAGGAGGATGTGGG - Intronic